ID: 1021136813

View in Genome Browser
Species Human (GRCh38)
Location 7:16974892-16974914
Sequence TTCAAGATGAGATTTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37009
Summary {0: 515, 1: 8500, 2: 11760, 3: 9478, 4: 6756}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021136807_1021136813 22 Left 1021136807 7:16974847-16974869 CCACGGTGTCCCTCCCATGACAT No data
Right 1021136813 7:16974892-16974914 TTCAAGATGAGATTTGAGTGTGG 0: 515
1: 8500
2: 11760
3: 9478
4: 6756
1021136806_1021136813 23 Left 1021136806 7:16974846-16974868 CCCACGGTGTCCCTCCCATGACA No data
Right 1021136813 7:16974892-16974914 TTCAAGATGAGATTTGAGTGTGG 0: 515
1: 8500
2: 11760
3: 9478
4: 6756
1021136805_1021136813 26 Left 1021136805 7:16974843-16974865 CCTCCCACGGTGTCCCTCCCATG No data
Right 1021136813 7:16974892-16974914 TTCAAGATGAGATTTGAGTGTGG 0: 515
1: 8500
2: 11760
3: 9478
4: 6756
1021136810_1021136813 9 Left 1021136810 7:16974860-16974882 CCCATGACATGTGAGAATTATGG No data
Right 1021136813 7:16974892-16974914 TTCAAGATGAGATTTGAGTGTGG 0: 515
1: 8500
2: 11760
3: 9478
4: 6756
1021136809_1021136813 12 Left 1021136809 7:16974857-16974879 CCTCCCATGACATGTGAGAATTA No data
Right 1021136813 7:16974892-16974914 TTCAAGATGAGATTTGAGTGTGG 0: 515
1: 8500
2: 11760
3: 9478
4: 6756
1021136812_1021136813 8 Left 1021136812 7:16974861-16974883 CCATGACATGTGAGAATTATGGA No data
Right 1021136813 7:16974892-16974914 TTCAAGATGAGATTTGAGTGTGG 0: 515
1: 8500
2: 11760
3: 9478
4: 6756
1021136808_1021136813 13 Left 1021136808 7:16974856-16974878 CCCTCCCATGACATGTGAGAATT No data
Right 1021136813 7:16974892-16974914 TTCAAGATGAGATTTGAGTGTGG 0: 515
1: 8500
2: 11760
3: 9478
4: 6756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021136813 Original CRISPR TTCAAGATGAGATTTGAGTG TGG Intergenic
Too many off-targets to display for this crispr