ID: 1021136850

View in Genome Browser
Species Human (GRCh38)
Location 7:16975577-16975599
Sequence CCATCCAATGATGAGCTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021136846_1021136850 18 Left 1021136846 7:16975536-16975558 CCATAAGATGCCATACTGTTACT No data
Right 1021136850 7:16975577-16975599 CCATCCAATGATGAGCTTTTTGG No data
1021136847_1021136850 8 Left 1021136847 7:16975546-16975568 CCATACTGTTACTTAGAGCTAGG No data
Right 1021136850 7:16975577-16975599 CCATCCAATGATGAGCTTTTTGG No data
1021136845_1021136850 25 Left 1021136845 7:16975529-16975551 CCACGAACCATAAGATGCCATAC No data
Right 1021136850 7:16975577-16975599 CCATCCAATGATGAGCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021136850 Original CRISPR CCATCCAATGATGAGCTTTT TGG Intergenic
No off target data available for this crispr