ID: 1021139872

View in Genome Browser
Species Human (GRCh38)
Location 7:17010968-17010990
Sequence AGTCCCCTGCTTCAAGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021139863_1021139872 4 Left 1021139863 7:17010941-17010963 CCCCCAATTTCTTCTCCTCTGCC No data
Right 1021139872 7:17010968-17010990 AGTCCCCTGCTTCAAGGGAATGG No data
1021139865_1021139872 2 Left 1021139865 7:17010943-17010965 CCCAATTTCTTCTCCTCTGCCCT No data
Right 1021139872 7:17010968-17010990 AGTCCCCTGCTTCAAGGGAATGG No data
1021139864_1021139872 3 Left 1021139864 7:17010942-17010964 CCCCAATTTCTTCTCCTCTGCCC No data
Right 1021139872 7:17010968-17010990 AGTCCCCTGCTTCAAGGGAATGG No data
1021139862_1021139872 29 Left 1021139862 7:17010916-17010938 CCTCTATAGAAACTTGCTGTCTG No data
Right 1021139872 7:17010968-17010990 AGTCCCCTGCTTCAAGGGAATGG No data
1021139866_1021139872 1 Left 1021139866 7:17010944-17010966 CCAATTTCTTCTCCTCTGCCCTT No data
Right 1021139872 7:17010968-17010990 AGTCCCCTGCTTCAAGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021139872 Original CRISPR AGTCCCCTGCTTCAAGGGAA TGG Intergenic
No off target data available for this crispr