ID: 1021144253

View in Genome Browser
Species Human (GRCh38)
Location 7:17065920-17065942
Sequence CAGCGAACAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021144253_1021144256 -2 Left 1021144253 7:17065920-17065942 CCGTCCACCACTGCTGTTCGCTG No data
Right 1021144256 7:17065941-17065963 TGCCATCCACCCCTCCAGATCGG No data
1021144253_1021144257 -1 Left 1021144253 7:17065920-17065942 CCGTCCACCACTGCTGTTCGCTG No data
Right 1021144257 7:17065942-17065964 GCCATCCACCCCTCCAGATCGGG No data
1021144253_1021144259 3 Left 1021144253 7:17065920-17065942 CCGTCCACCACTGCTGTTCGCTG No data
Right 1021144259 7:17065946-17065968 TCCACCCCTCCAGATCGGGCAGG No data
1021144253_1021144261 4 Left 1021144253 7:17065920-17065942 CCGTCCACCACTGCTGTTCGCTG No data
Right 1021144261 7:17065947-17065969 CCACCCCTCCAGATCGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021144253 Original CRISPR CAGCGAACAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr