ID: 1021147400

View in Genome Browser
Species Human (GRCh38)
Location 7:17106165-17106187
Sequence GTGGCCACCCACACTGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021147392_1021147400 25 Left 1021147392 7:17106117-17106139 CCTTCTTCCACCTGCTTTCTTCT No data
Right 1021147400 7:17106165-17106187 GTGGCCACCCACACTGAGAGTGG No data
1021147393_1021147400 18 Left 1021147393 7:17106124-17106146 CCACCTGCTTTCTTCTAGCCAAG No data
Right 1021147400 7:17106165-17106187 GTGGCCACCCACACTGAGAGTGG No data
1021147397_1021147400 0 Left 1021147397 7:17106142-17106164 CCAAGTTGGCAGCTGATTGGATG No data
Right 1021147400 7:17106165-17106187 GTGGCCACCCACACTGAGAGTGG No data
1021147391_1021147400 28 Left 1021147391 7:17106114-17106136 CCACCTTCTTCCACCTGCTTTCT No data
Right 1021147400 7:17106165-17106187 GTGGCCACCCACACTGAGAGTGG No data
1021147394_1021147400 15 Left 1021147394 7:17106127-17106149 CCTGCTTTCTTCTAGCCAAGTTG No data
Right 1021147400 7:17106165-17106187 GTGGCCACCCACACTGAGAGTGG No data
1021147390_1021147400 29 Left 1021147390 7:17106113-17106135 CCCACCTTCTTCCACCTGCTTTC No data
Right 1021147400 7:17106165-17106187 GTGGCCACCCACACTGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021147400 Original CRISPR GTGGCCACCCACACTGAGAG TGG Intergenic
No off target data available for this crispr