ID: 1021158048

View in Genome Browser
Species Human (GRCh38)
Location 7:17236287-17236309
Sequence TCACCCAGGAATTTAAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021158048_1021158051 1 Left 1021158048 7:17236287-17236309 CCTCCTTTTAAATTCCTGGGTGA No data
Right 1021158051 7:17236311-17236333 GTTATCTATTTCCTTCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021158048 Original CRISPR TCACCCAGGAATTTAAAAGG AGG (reversed) Intergenic
No off target data available for this crispr