ID: 1021158051

View in Genome Browser
Species Human (GRCh38)
Location 7:17236311-17236333
Sequence GTTATCTATTTCCTTCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021158049_1021158051 -2 Left 1021158049 7:17236290-17236312 CCTTTTAAATTCCTGGGTGATGT No data
Right 1021158051 7:17236311-17236333 GTTATCTATTTCCTTCACTTTGG No data
1021158045_1021158051 11 Left 1021158045 7:17236277-17236299 CCATTGTTTGCCTCCTTTTAAAT No data
Right 1021158051 7:17236311-17236333 GTTATCTATTTCCTTCACTTTGG No data
1021158048_1021158051 1 Left 1021158048 7:17236287-17236309 CCTCCTTTTAAATTCCTGGGTGA No data
Right 1021158051 7:17236311-17236333 GTTATCTATTTCCTTCACTTTGG No data
1021158043_1021158051 29 Left 1021158043 7:17236259-17236281 CCCTACAGACTCATTCTTCCATT No data
Right 1021158051 7:17236311-17236333 GTTATCTATTTCCTTCACTTTGG No data
1021158044_1021158051 28 Left 1021158044 7:17236260-17236282 CCTACAGACTCATTCTTCCATTG No data
Right 1021158051 7:17236311-17236333 GTTATCTATTTCCTTCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021158051 Original CRISPR GTTATCTATTTCCTTCACTT TGG Intergenic
No off target data available for this crispr