ID: 1021162967

View in Genome Browser
Species Human (GRCh38)
Location 7:17298814-17298836
Sequence AGGTGCCGCCGCGCTGCTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021162967_1021162968 -10 Left 1021162967 7:17298814-17298836 CCGGGAGCAGCGCGGCGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1021162968 7:17298827-17298849 GGCGGCACCTCCCTCACCCAAGG 0: 1
1: 0
2: 0
3: 24
4: 201
1021162967_1021162975 4 Left 1021162967 7:17298814-17298836 CCGGGAGCAGCGCGGCGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1021162975 7:17298841-17298863 CACCCAAGGGGCCGCGGCGACGG 0: 1
1: 0
2: 0
3: 7
4: 76
1021162967_1021162969 -9 Left 1021162967 7:17298814-17298836 CCGGGAGCAGCGCGGCGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1021162969 7:17298828-17298850 GCGGCACCTCCCTCACCCAAGGG 0: 1
1: 0
2: 8
3: 10
4: 109
1021162967_1021162972 -2 Left 1021162967 7:17298814-17298836 CCGGGAGCAGCGCGGCGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1021162972 7:17298835-17298857 CTCCCTCACCCAAGGGGCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 175
1021162967_1021162970 -8 Left 1021162967 7:17298814-17298836 CCGGGAGCAGCGCGGCGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1021162970 7:17298829-17298851 CGGCACCTCCCTCACCCAAGGGG 0: 1
1: 0
2: 6
3: 13
4: 141
1021162967_1021162979 11 Left 1021162967 7:17298814-17298836 CCGGGAGCAGCGCGGCGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1021162979 7:17298848-17298870 GGGGCCGCGGCGACGGTCACGGG 0: 1
1: 0
2: 0
3: 6
4: 95
1021162967_1021162982 17 Left 1021162967 7:17298814-17298836 CCGGGAGCAGCGCGGCGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1021162982 7:17298854-17298876 GCGGCGACGGTCACGGGGCGCGG 0: 1
1: 0
2: 1
3: 25
4: 193
1021162967_1021162978 10 Left 1021162967 7:17298814-17298836 CCGGGAGCAGCGCGGCGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1021162978 7:17298847-17298869 AGGGGCCGCGGCGACGGTCACGG 0: 1
1: 0
2: 1
3: 6
4: 76
1021162967_1021162980 12 Left 1021162967 7:17298814-17298836 CCGGGAGCAGCGCGGCGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1021162980 7:17298849-17298871 GGGCCGCGGCGACGGTCACGGGG 0: 1
1: 0
2: 1
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021162967 Original CRISPR AGGTGCCGCCGCGCTGCTCC CGG (reversed) Exonic
900610920 1:3544331-3544353 AGGTGCCGCCCTGCAGCCCCAGG - Intronic
906526733 1:46497921-46497943 AGGTGCCGCCCCGCAATTCCTGG - Intergenic
911151492 1:94600694-94600716 AGGTGAGGCTGCCCTGCTCCTGG - Intergenic
912955449 1:114152253-114152275 TGGTCCCCACGCGCTGCTCCAGG - Intronic
913222080 1:116667720-116667742 AGGGGCCGCAGCGCGGCTGCTGG - Exonic
914492395 1:148160538-148160560 AGGAGCAGCCGCCTTGCTCCTGG + Intergenic
916390051 1:164321454-164321476 CGCCGCCGCCGCCCTGCTCCTGG + Intergenic
919934997 1:202245474-202245496 AGGTGTTCCCGCACTGCTCCTGG - Intronic
924560662 1:245154790-245154812 AGGCTCCTCCGCGCTGCGCCCGG + Intergenic
924577822 1:245296471-245296493 AGGTGCCACCGGGCAGCTGCTGG + Intronic
1063458763 10:6202732-6202754 AGCTCCCGCCGCCCTGCCCCGGG - Intronic
1065367809 10:24952549-24952571 TGGCGCCTCCTCGCTGCTCCCGG + Exonic
1067227369 10:44384870-44384892 AGGAGCCGCGGCTCTGCGCCGGG + Intronic
1068762921 10:60733122-60733144 AGGCGGCGCCGCGAGGCTCCGGG - Intronic
1071997477 10:91162700-91162722 AGCCGCCGCCGCGCAGCTCCCGG - Intergenic
1072757556 10:98030834-98030856 AGTGGCCGCCGCGCCGCGCCGGG - Intergenic
1073180386 10:101579721-101579743 CGGTGCCGCCGCCCTGGCCCTGG + Exonic
1073268299 10:102241428-102241450 GGGGGCCGCCCCCCTGCTCCCGG + Exonic
1076803596 10:132844184-132844206 GGGTGCTGCGGGGCTGCTCCTGG + Intronic
1077065508 11:639417-639439 TGGTGTCGCCGCGCAGGTCCAGG + Exonic
1079071864 11:17353762-17353784 AGCCGCCGCCGCGCTCCTCGTGG - Intronic
1083241580 11:61392592-61392614 CGGCAGCGCCGCGCTGCTCCGGG + Exonic
1083340537 11:61955961-61955983 CGGTGCCTCCCCGTTGCTCCCGG - Intronic
1084288530 11:68146999-68147021 AGGTTCCACATCGCTGCTCCTGG - Intergenic
1084321786 11:68377356-68377378 AGGTGCCTGCCAGCTGCTCCTGG + Intronic
1084975074 11:72792609-72792631 AGGTGCCACCTCGCTTCACCTGG + Intronic
1085456907 11:76670613-76670635 AGCTGCGGCCGCGCTGAGCCAGG - Intronic
1089494190 11:118900155-118900177 AGGTGCTGAGGAGCTGCTCCGGG + Exonic
1098477350 12:70920710-70920732 AGTAGCCGCGGCGCTGCTGCTGG - Exonic
1100260481 12:92928739-92928761 TGGTGCCGGCGCGTTCCTCCCGG - Intronic
1113481644 13:110626024-110626046 AGGAGCCGGCGCGGAGCTCCAGG + Intronic
1113811247 13:113143911-113143933 AGGGGCCTCCCCGCTGCTGCTGG - Exonic
1114461200 14:22887063-22887085 AGGTGCCGCCGAGCGGCCCCGGG - Exonic
1115399090 14:32938695-32938717 ACCTGCCACCGGGCTGCTCCGGG + Intronic
1117598230 14:57345398-57345420 AGGTGCAGCCGCGCTTCCACAGG - Intergenic
1118386573 14:65260522-65260544 AGGTGCCGCCTGTCTGCTCAAGG - Intergenic
1120521226 14:85530309-85530331 AGATGCCGCCTCGCCGCTGCTGG - Exonic
1121168815 14:91836294-91836316 GGGTCCCGCCGCCCTCCTCCGGG + Intronic
1122209432 14:100165540-100165562 AGGCGCCACTGCGCTGCTCTCGG + Intergenic
1124348376 15:28937454-28937476 AGGTGGAGCCTCGCTGCTCTGGG + Intronic
1128413039 15:67418152-67418174 AGCTACCTCCGTGCTGCTCCAGG + Intronic
1129468672 15:75738396-75738418 AGGTGCCCTCGCGCCCCTCCCGG - Intergenic
1129539322 15:76338089-76338111 GGGTGCCGCAGCGCTCCCCCGGG + Intronic
1129589881 15:76905420-76905442 AGCCGCTGCCGCGCCGCTCCCGG + Intronic
1131049072 15:89334570-89334592 ACTAGCCGCCGCCCTGCTCCGGG + Intronic
1132560569 16:591411-591433 AGGTGCTGCTGGGCTGCTCTTGG + Intronic
1132571531 16:646495-646517 AGGTGCCCCAGCGCCGCTCTCGG - Intronic
1132758226 16:1496267-1496289 AGGGGGCGCCGAGCTGCTCCAGG - Intronic
1132929065 16:2449419-2449441 GGCTGCCGCAGCCCTGCTCCTGG + Exonic
1134402189 16:13920371-13920393 AGGTGCGGCCGCGCTGGCGCGGG + Exonic
1136666921 16:31820099-31820121 GGGGGCTGCGGCGCTGCTCCCGG - Intergenic
1141510949 16:84511809-84511831 AGGTGTCCCCAGGCTGCTCCTGG + Intronic
1143452139 17:7042641-7042663 CGGGGCCTCCTCGCTGCTCCTGG - Exonic
1144456938 17:15426539-15426561 TGGTGCCGCCTCTGTGCTCCGGG - Intergenic
1147661091 17:42117530-42117552 TGATGCCGCGGCGCTCCTCCAGG + Exonic
1147970879 17:44218812-44218834 CGGTGCGGCCGCTCCGCTCCGGG - Intronic
1148157492 17:45432226-45432248 AGGCCCGGCCGGGCTGCTCCGGG - Intronic
1150168468 17:62966585-62966607 AGGCCCCGCCGCGCCGTTCCGGG + Intergenic
1150293936 17:63998158-63998180 ACCTCCCGCCGCGCTGCTCGGGG - Intergenic
1150344391 17:64393156-64393178 AGATGGTGCCGCGCAGCTCCAGG - Intronic
1151188900 17:72383256-72383278 AGCTCCAGCCCCGCTGCTCCCGG - Intergenic
1151451846 17:74202910-74202932 AGCTGTCGCAGCGCTGCCCCTGG - Intergenic
1152116344 17:78389962-78389984 AGGTGCCGCTGTACTGCTCCAGG - Intronic
1152227945 17:79101432-79101454 TGGGGCTGCCGCTCTGCTCCCGG - Intronic
1152525275 17:80884805-80884827 AGGGGCAGCCGCCCAGCTCCAGG - Intronic
1153591942 18:6683360-6683382 AGGTGGGGCCGCGCTGCCTCTGG + Intergenic
1160515358 18:79476478-79476500 TGGTGGCCCCGTGCTGCTCCAGG - Intronic
1160863901 19:1249014-1249036 AGGGGGCGCCGCGCTGCCCCTGG - Intronic
1161258245 19:3321596-3321618 AGGTGCCTCCGCCCTGCTAGGGG - Intergenic
1161979358 19:7622535-7622557 AGGTGCCGAGGCTCTCCTCCAGG + Exonic
1162379467 19:10323084-10323106 AGGGGCTGCAGCGCTGCCCCCGG - Intronic
1163792485 19:19315765-19315787 AGGTGCCGCCCCAGAGCTCCTGG - Intronic
1163804117 19:19385878-19385900 AGGAGCCGCCGCGCAGCGCTCGG - Exonic
1164780425 19:30887127-30887149 AGGAGGCTCCGCGCTGCTCCAGG - Intergenic
1165080147 19:33302249-33302271 AGATGCCGCCCAGCGGCTCCGGG + Exonic
927181089 2:20447240-20447262 GCGTCTCGCCGCGCTGCTCCCGG - Exonic
929431658 2:41892726-41892748 AGGTGGCGACGAGCTGCTCATGG + Intergenic
933063480 2:77767686-77767708 AGGTGCCTCCTCGCAGCTTCAGG - Intergenic
935275693 2:101474034-101474056 AGGTCCCTCCGCGCTGCGGCGGG + Intronic
936161028 2:110084442-110084464 AGGTGGCGCAGCGCGGTTCCTGG + Exonic
936183635 2:110286912-110286934 AGGTGGCGCAGCGCGGTTCCTGG - Intergenic
948140564 2:235669805-235669827 AGGTGCGGCCGCGGTGCGCAGGG - Intronic
948767405 2:240230346-240230368 AGGTGCCTCAGCGATGGTCCAGG + Intergenic
1171121246 20:22571126-22571148 AGGTGCAGCAGCTCTGCTTCTGG - Intergenic
1174568795 20:51486323-51486345 AGGGGCCTCCTTGCTGCTCCTGG + Intronic
1174658670 20:52192077-52192099 CCGTGCAGCAGCGCTGCTCCCGG + Intronic
1175142850 20:56873559-56873581 AGGTGCCGCTCAGCAGCTCCGGG + Intergenic
1175428990 20:58889746-58889768 GGTTCCCGCCGCGCTGCCCCGGG - Intronic
1176058684 20:63162287-63162309 GGGTGCCACGGCGGTGCTCCAGG - Intergenic
1176521199 21:7825804-7825826 GGGTGGCGCCTCGCTGCTCTGGG + Intronic
1177710564 21:24768368-24768390 TGGTGCTGCCGCGCTCCCCCAGG + Intergenic
1178655219 21:34455816-34455838 GGGTGGCGCCTCGCTGCTCTGGG + Intergenic
1180179436 21:46111464-46111486 AGGTGCTGCCAAGATGCTCCAGG + Exonic
1181563190 22:23717437-23717459 AGGCGCCGCCCCGCCCCTCCAGG - Intergenic
1183491005 22:38115638-38115660 AGGAGCTGCCCCGCTGCTTCGGG + Exonic
1183666103 22:39246761-39246783 TGGTGGCCCCGCACTGCTCCAGG + Intergenic
1183969996 22:41469426-41469448 AGGTGCCTCCGCTCTTCACCCGG - Intronic
1184410290 22:44322353-44322375 AGGTGCTGCCTCACTGCCCCAGG + Intergenic
1184748692 22:46472057-46472079 AGGTGCCGCGGAGCCGCTCCAGG - Intronic
1184871987 22:47246599-47246621 TGGTGCCGCCTCTCTCCTCCAGG + Intergenic
950023623 3:9806288-9806310 TGCCGCCGCCGCGCTGCTCGGGG - Exonic
951694108 3:25427986-25428008 AGGAGCCGGGACGCTGCTCCTGG - Intronic
964958217 3:162389110-162389132 AGGTGCCCCCGCACTGTGCCTGG - Intergenic
968554691 4:1240945-1240967 AGGGGCCACGGCCCTGCTCCTGG + Intronic
975778761 4:77818866-77818888 CGGTGCCGCGCCGCTGATCCCGG - Intronic
982198115 4:152936230-152936252 AGCTGCGGCCTCGCTGCTCCTGG - Intergenic
985588370 5:752254-752276 AGGTGTGGCCGGGCTCCTCCAGG - Intronic
985603043 5:844709-844731 AGGTGTGGCCGGGCTCCTCCAGG - Intronic
985652043 5:1111850-1111872 AGGTGCGGCCGCGCTCACCCGGG + Exonic
991422191 5:66453124-66453146 TGGTGCTGCTGAGCTGCTCCAGG + Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
1002548009 5:179964707-179964729 AGGTCACGCAGCACTGCTCCTGG + Intronic
1005835088 6:29702696-29702718 GGGCGCCGCTGCGCTGCTCTCGG + Intergenic
1006271076 6:32968315-32968337 AGGTGCGGCTTCGCTGGTCCTGG - Intronic
1016713985 6:147203699-147203721 AGGTACCGCAGCCCGGCTCCTGG + Intergenic
1018098726 6:160417333-160417355 AGCTGCTGCAGCTCTGCTCCAGG - Intronic
1018765122 6:166926852-166926874 TGGTGCCGCAGAGATGCTCCAGG + Intronic
1021162967 7:17298814-17298836 AGGTGCCGCCGCGCTGCTCCCGG - Exonic
1024965355 7:55019033-55019055 TGCTGCGGCCGCGCTGCGCCGGG - Intronic
1027320211 7:77005968-77005990 AGGTGCCCACCCGCTCCTCCTGG - Intergenic
1029927012 7:104328809-104328831 CGCCGCCGCCGCGATGCTCCCGG + Exonic
1032502825 7:132412837-132412859 AGGTCCCTCCCCGGTGCTCCAGG - Intronic
1037947797 8:22999968-22999990 CGGCGCCGCCGCGCTGCTGCTGG - Intronic
1038554093 8:28494465-28494487 AGGAGGCGCCGGGCTGCTGCTGG - Intronic
1038691556 8:29768276-29768298 AGGTGCTGCTGTCCTGCTCCTGG - Intergenic
1038963587 8:32548343-32548365 AGCCGCCGCCGCTCAGCTCCTGG - Intronic
1042695219 8:71547839-71547861 AAGTGCAGCCGCGCTGCCCGGGG - Intronic
1045231435 8:100310284-100310306 AGGAGCCGCCCCGCTGCACCCGG + Intronic
1047387813 8:124426024-124426046 AGGTGCCTTCCCGCTGCTGCGGG + Intergenic
1052970936 9:34376868-34376890 AGCTGCCGCCGCGCCGCGCGGGG + Intergenic
1053151944 9:35749130-35749152 AGGTCCCGCCGGCCGGCTCCGGG + Exonic
1057623267 9:96655224-96655246 CGGCGCCGCCGCCCTGGTCCCGG - Exonic
1059348932 9:113650817-113650839 AGGTTCCGCCTGCCTGCTCCAGG - Intergenic
1060527000 9:124326453-124326475 AGGTGGCTCCGGGCGGCTCCTGG - Intronic
1060814125 9:126625932-126625954 AGAAGCGGCCGCGCTGTTCCGGG + Intronic
1061261244 9:129482225-129482247 AGGTTCCCCCGCGCTCCTCCCGG + Intergenic
1062493720 9:136821846-136821868 AGGAGGCTCCGCGCTTCTCCCGG - Intronic
1062526593 9:136980373-136980395 AGGTGGCCCCGCCCTGCTCGAGG + Intronic
1189324653 X:40105283-40105305 TGCTGCCGCCGCGCGGCTCTCGG - Intronic