ID: 1021165415

View in Genome Browser
Species Human (GRCh38)
Location 7:17333672-17333694
Sequence GAACCACTCCTTGTTCCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021165415_1021165418 29 Left 1021165415 7:17333672-17333694 CCATTAGGAACAAGGAGTGGTTC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 1021165418 7:17333724-17333746 ACTCTTTGAGATAGATTTAATGG 0: 1
1: 0
2: 0
3: 19
4: 227
1021165415_1021165419 30 Left 1021165415 7:17333672-17333694 CCATTAGGAACAAGGAGTGGTTC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 1021165419 7:17333725-17333747 CTCTTTGAGATAGATTTAATGGG 0: 1
1: 0
2: 2
3: 13
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021165415 Original CRISPR GAACCACTCCTTGTTCCTAA TGG (reversed) Intronic
902372147 1:16013640-16013662 GAAGCCCTTCTTGTACCTAATGG - Intergenic
904901940 1:33864611-33864633 GAGCCACTCTTTGCTCATAAGGG - Exonic
906076411 1:43055374-43055396 CAACCACTCCATTTTCCTGAAGG - Intergenic
906243924 1:44259967-44259989 CTACCCCTCCTTATTCCTAAGGG + Intronic
907798224 1:57738831-57738853 GAACAATTCCTTGAACCTAATGG - Intronic
908495753 1:64693084-64693106 GTACCACTCCTTGTGCCTCAAGG + Intergenic
908618491 1:65949555-65949577 GAACCACTTCCAGTTCCTGATGG + Intronic
909851150 1:80465644-80465666 TAACCACTACTAGTCCCTAACGG + Intergenic
917463470 1:175253399-175253421 GAACCTCCCCTTTCTCCTAAGGG + Intergenic
920807203 1:209246017-209246039 GTACCACTCCCTGTTCCTCGGGG - Intergenic
1063220647 10:3964376-3964398 GTACCATTTCATGTTCCTAAAGG + Intergenic
1067996068 10:51274723-51274745 AATCCATTCCTAGTTCCTAAAGG + Intronic
1070770699 10:79080766-79080788 GACCCACTCCTTCTGCCTAAAGG - Intronic
1073301010 10:102470958-102470980 GAAATCCTCCTTGTTCCAAAAGG - Exonic
1073732903 10:106311740-106311762 GAACCACGTGTTGTTCCTAAGGG - Intergenic
1074306530 10:112284268-112284290 GATACATTCCTTGTTCCAAATGG + Intronic
1074852772 10:117452115-117452137 GCATCACTCCTTGTTCTTAGAGG - Intergenic
1077411199 11:2404754-2404776 GAACCGCTCCTTGTCCCTCCTGG - Exonic
1077629167 11:3798943-3798965 GAACCCCTACTTATTCTTAAAGG + Intronic
1083069889 11:59967060-59967082 TACCTACTCCATGTTCCTAAAGG - Intergenic
1087899687 11:103626697-103626719 GAACCAATCCTTCTGCCTGAGGG + Intergenic
1095243908 12:39895173-39895195 GACCCACTACTTGTTACTCAGGG - Intronic
1105517837 13:21106056-21106078 GAACAACTCCTTGTGCCAAGCGG + Intergenic
1109424112 13:62149930-62149952 AAACCACTCCTTGTCCCTGGTGG + Intergenic
1125050172 15:35288291-35288313 AAACCTTTCCTTTTTCCTAAAGG - Intronic
1125509955 15:40287535-40287557 CAACCACTCTGTCTTCCTAAAGG + Intronic
1126865383 15:52931836-52931858 TAACCATTCCTTATTCCTATGGG + Intergenic
1130191320 15:81738759-81738781 GAACCACTTCTGTTTACTAAAGG + Intergenic
1134137052 16:11684036-11684058 CCACCACGCCTGGTTCCTAAGGG + Intronic
1134829192 16:17309722-17309744 GAAGCACTTCTTGTCCCAAATGG + Intronic
1134882482 16:17757859-17757881 AAACCACTCCTTCCACCTAAGGG - Intergenic
1135134401 16:19876942-19876964 GAACCACTCACTGTGGCTAAGGG - Intronic
1137787285 16:51150092-51150114 GAATCCCTCCTTGCTCCTAAAGG - Intronic
1139330813 16:66188568-66188590 AAACCACTCCTTTTTCATCAGGG - Intergenic
1143644096 17:8218572-8218594 GACCCAAACCTTGTTCCTGAAGG - Intergenic
1146118187 17:30162571-30162593 GAACCAATCCTTCTTTCAAATGG - Intronic
1147610084 17:41796672-41796694 GGGCCACTCTTTGTTCCCAAGGG + Intergenic
1152724886 17:81940274-81940296 GAACCACTCCTGGTTCAGAGAGG - Exonic
1155753932 18:29466003-29466025 GAACCCCTCCTTGTCCCAAAGGG + Intergenic
1157165925 18:45358392-45358414 AAACCACTCCCTGCTCCTATAGG + Intronic
1159117034 18:64126519-64126541 GAACAGCTCCTTGTTCATAGAGG - Intergenic
1168140024 19:54379852-54379874 TGACCACTCCTTGCTCCTGAGGG - Intergenic
927151804 2:20200539-20200561 CCAGCACTCCTTGTTCCTTAAGG - Intergenic
931951474 2:67368127-67368149 GGACCAATCTTTGCTCCTAAAGG + Intergenic
933178868 2:79207633-79207655 GAACCACCACTTGTTCTTCATGG - Intronic
934640435 2:96024353-96024375 GAACGGCTCCTTCTTCATAATGG - Intronic
936573132 2:113632961-113632983 GAAGTACTCCTTGTTCCTGTGGG + Intronic
937885755 2:126899065-126899087 TATTCACTCCTTGTTCCTAGAGG + Intronic
939977128 2:148731309-148731331 CAAGCACACCTTGTTTCTAAAGG - Intronic
941788341 2:169523102-169523124 GAAGCCCTCCTGGTTCCTAAGGG + Intronic
947359214 2:229330822-229330844 AAATCACTCTTTCTTCCTAATGG + Intergenic
947887581 2:233586060-233586082 GAACCACATCTTCTTCTTAAAGG + Intergenic
1169860310 20:10144306-10144328 TAACCTCTCCTTGTTACTGAGGG - Intergenic
1174047205 20:47741900-47741922 GAACCATTTCTTGTTTTTAATGG + Intronic
1176018161 20:62948486-62948508 GAAGCTCTCTTTTTTCCTAAGGG + Intergenic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
950637312 3:14324167-14324189 GAACCGCTCCTAGTTCCTCAAGG + Intergenic
952583511 3:34863863-34863885 GAACCACTCCTTGATATTGATGG - Intergenic
954357855 3:50097645-50097667 GACCAACTCCTTTTTCCAAAAGG - Intronic
954720362 3:52556750-52556772 TAACCACTCTTTGGTCCTCATGG - Intronic
955392793 3:58533551-58533573 ACACCTCTCCTTGATCCTAAGGG - Exonic
957744484 3:84321237-84321259 AACCCACTCCTTTTTCCTATTGG - Intergenic
966068120 3:175841081-175841103 TAACCTCTCCTTTTTCCCAATGG + Intergenic
967648536 3:191956683-191956705 GAACCACTCCATTTTCCAGATGG + Intergenic
976730932 4:88260413-88260435 GAAATTCTCCATGTTCCTAAAGG + Exonic
978989761 4:115066011-115066033 TAAACACTCCTGGTTCCTAGAGG + Intronic
980309121 4:131102635-131102657 GAACCACCCCCTGTCCCTACAGG - Intergenic
986569866 5:9153653-9153675 CAACCACTCCTTCTTCTCAAGGG + Intronic
987153450 5:15063547-15063569 GACCCAAACCTTATTCCTAAAGG - Intergenic
987153627 5:15065309-15065331 GATGCATTCCTTGTTCTTAATGG + Intergenic
987557178 5:19468053-19468075 GTATCACTCCTTGGTCCTACAGG + Intergenic
990598325 5:57332960-57332982 GAGCCACCCCTTCTGCCTAATGG + Intergenic
993792864 5:92228737-92228759 GAGCCATTTCTTTTTCCTAAAGG - Intergenic
996167333 5:120241330-120241352 GAAAGCCTCCTTGTCCCTAAGGG - Intergenic
998144170 5:139716814-139716836 GAACCTCTCCTTGTGCCACACGG + Intergenic
1005315353 6:24598343-24598365 GAACCATACCTTGTTGATAAAGG - Intronic
1007919954 6:45598021-45598043 GAGCCACTCCTTCTTCCAAAGGG + Intronic
1008253822 6:49273699-49273721 GAACCACTAGTTGTCCCCAATGG - Intergenic
1014050334 6:116945406-116945428 GAACCATTCCTTTTATCTAAGGG - Intergenic
1021165415 7:17333672-17333694 GAACCACTCCTTGTTCCTAATGG - Intronic
1034485126 7:151355775-151355797 GAGCCACGCCTTGTTCTTCAAGG - Exonic
1036500674 8:9311173-9311195 GAAAAAGTGCTTGTTCCTAAAGG + Intergenic
1037878429 8:22560945-22560967 GACCCACTCCTAGCTCCTCAAGG - Intronic
1039280675 8:35980446-35980468 GGTCCACTCCTTTTTACTAAAGG - Intergenic
1039830273 8:41207764-41207786 TAATCTCTCCTTGTTCCCAAAGG + Intergenic
1040869688 8:52087927-52087949 AAATGAATCCTTGTTCCTAAGGG + Intergenic
1041669707 8:60479905-60479927 TAACCAATCCTGGTTCCTAAAGG + Intergenic
1043337421 8:79193614-79193636 AACCCACTCCTTGTTCCTTGTGG - Intergenic
1044072289 8:87777776-87777798 GAGCCTCTCCGTGTTCCTAGTGG - Intergenic
1047373500 8:124275322-124275344 CCACCTCTCTTTGTTCCTAAAGG - Intergenic
1049981820 9:910968-910990 GAGCCACTCAGTTTTCCTAAAGG - Intronic
1050555053 9:6782615-6782637 AAACCACTCGATGTTCCCAAAGG - Intronic
1056390443 9:86136531-86136553 AAACAACTCTTTGTTCCTTAAGG + Intergenic
1056986210 9:91365457-91365479 GGACCACCCATTGTTTCTAAAGG + Intergenic
1057057057 9:91971458-91971480 TAACCTCTCCTCATTCCTAATGG - Intergenic
1057725099 9:97562795-97562817 GAGCCCCTCCTTGTTCATGATGG - Exonic
1060935061 9:127509896-127509918 GCACCACTCTTGGTTTCTAAAGG + Intronic
1188359404 X:29233953-29233975 GAGCCACTCTTTGCTCCTAGAGG - Intronic
1188502922 X:30848571-30848593 GAACCACTCGATCTTACTAAGGG + Intronic
1193607129 X:83582764-83582786 GAAGCAATCTATGTTCCTAAGGG - Intergenic
1193706899 X:84832192-84832214 GAACCACCCTCTGTTCCTAAGGG - Intergenic
1194579925 X:95659430-95659452 GATCCTCTCCTAGTTCCTTAAGG - Intergenic
1194938712 X:99983200-99983222 TAACCACACCTTTTTTCTAAGGG - Intergenic
1201355766 Y:13095654-13095676 GATCCACTCGTGGTTTCTAATGG - Intergenic