ID: 1021168905

View in Genome Browser
Species Human (GRCh38)
Location 7:17374062-17374084
Sequence CAACTTTAACACCTTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021168905_1021168908 20 Left 1021168905 7:17374062-17374084 CCAGGTGTAAGGTGTTAAAGTTG No data
Right 1021168908 7:17374105-17374127 CCTTCAAGTCATTCCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021168905 Original CRISPR CAACTTTAACACCTTACACC TGG (reversed) Intergenic
No off target data available for this crispr