ID: 1021181079

View in Genome Browser
Species Human (GRCh38)
Location 7:17506793-17506815
Sequence TTGGCTAAAGGCAGGCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021181074_1021181079 6 Left 1021181074 7:17506764-17506786 CCAACTTTTATAACTGGCAAGCA No data
Right 1021181079 7:17506793-17506815 TTGGCTAAAGGCAGGCATCTGGG No data
1021181073_1021181079 7 Left 1021181073 7:17506763-17506785 CCCAACTTTTATAACTGGCAAGC No data
Right 1021181079 7:17506793-17506815 TTGGCTAAAGGCAGGCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021181079 Original CRISPR TTGGCTAAAGGCAGGCATCT GGG Intergenic
No off target data available for this crispr