ID: 1021182282

View in Genome Browser
Species Human (GRCh38)
Location 7:17520539-17520561
Sequence GAAGTTCCAAACTAGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021182282_1021182284 -7 Left 1021182282 7:17520539-17520561 CCATGCTGCTAGTTTGGAACTTC No data
Right 1021182284 7:17520555-17520577 GAACTTCTTTGAATAACAACGGG No data
1021182282_1021182283 -8 Left 1021182282 7:17520539-17520561 CCATGCTGCTAGTTTGGAACTTC No data
Right 1021182283 7:17520554-17520576 GGAACTTCTTTGAATAACAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021182282 Original CRISPR GAAGTTCCAAACTAGCAGCA TGG (reversed) Intergenic
No off target data available for this crispr