ID: 1021189351

View in Genome Browser
Species Human (GRCh38)
Location 7:17602444-17602466
Sequence GCTCTCCCCCATCACAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021189345_1021189351 26 Left 1021189345 7:17602395-17602417 CCACAGCTAGGACTGTGGAAAGT No data
Right 1021189351 7:17602444-17602466 GCTCTCCCCCATCACAGGTGTGG No data
1021189344_1021189351 29 Left 1021189344 7:17602392-17602414 CCTCCACAGCTAGGACTGTGGAA No data
Right 1021189351 7:17602444-17602466 GCTCTCCCCCATCACAGGTGTGG No data
1021189348_1021189351 2 Left 1021189348 7:17602419-17602441 CCTCAGGAGTAGATCCTGGAATT No data
Right 1021189351 7:17602444-17602466 GCTCTCCCCCATCACAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021189351 Original CRISPR GCTCTCCCCCATCACAGGTG TGG Intergenic
No off target data available for this crispr