ID: 1021189665

View in Genome Browser
Species Human (GRCh38)
Location 7:17605194-17605216
Sequence ATCAGTAAAAAAAAGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021189660_1021189665 14 Left 1021189660 7:17605157-17605179 CCATTCATATATTAAATAAAATA No data
Right 1021189665 7:17605194-17605216 ATCAGTAAAAAAAAGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021189665 Original CRISPR ATCAGTAAAAAAAAGGATGG GGG Intergenic
No off target data available for this crispr