ID: 1021191204

View in Genome Browser
Species Human (GRCh38)
Location 7:17621694-17621716
Sequence CAGTCACCATACCATGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021191204_1021191205 6 Left 1021191204 7:17621694-17621716 CCAAAGGCATGGTATGGTGACTG No data
Right 1021191205 7:17621723-17621745 ACAACAATGTGTTATATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021191204 Original CRISPR CAGTCACCATACCATGCCTT TGG (reversed) Intergenic
No off target data available for this crispr