ID: 1021195654

View in Genome Browser
Species Human (GRCh38)
Location 7:17671678-17671700
Sequence CTACCATTGGTAAAGCCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021195654_1021195656 27 Left 1021195654 7:17671678-17671700 CCTAAAGGCTTTACCAATGGTAG No data
Right 1021195656 7:17671728-17671750 CAATTGAAAAAGATTTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021195654 Original CRISPR CTACCATTGGTAAAGCCTTT AGG (reversed) Intergenic
No off target data available for this crispr