ID: 1021195655

View in Genome Browser
Species Human (GRCh38)
Location 7:17671691-17671713
Sequence TTTGCTAGATGTGCTACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021195655_1021195658 19 Left 1021195655 7:17671691-17671713 CCAATGGTAGCACATCTAGCAAA No data
Right 1021195658 7:17671733-17671755 GAAAAAGATTTACAATGGCTGGG No data
1021195655_1021195662 25 Left 1021195655 7:17671691-17671713 CCAATGGTAGCACATCTAGCAAA No data
Right 1021195662 7:17671739-17671761 GATTTACAATGGCTGGGGGAGGG No data
1021195655_1021195663 26 Left 1021195655 7:17671691-17671713 CCAATGGTAGCACATCTAGCAAA No data
Right 1021195663 7:17671740-17671762 ATTTACAATGGCTGGGGGAGGGG No data
1021195655_1021195657 18 Left 1021195655 7:17671691-17671713 CCAATGGTAGCACATCTAGCAAA No data
Right 1021195657 7:17671732-17671754 TGAAAAAGATTTACAATGGCTGG No data
1021195655_1021195659 20 Left 1021195655 7:17671691-17671713 CCAATGGTAGCACATCTAGCAAA No data
Right 1021195659 7:17671734-17671756 AAAAAGATTTACAATGGCTGGGG No data
1021195655_1021195660 21 Left 1021195655 7:17671691-17671713 CCAATGGTAGCACATCTAGCAAA No data
Right 1021195660 7:17671735-17671757 AAAAGATTTACAATGGCTGGGGG No data
1021195655_1021195656 14 Left 1021195655 7:17671691-17671713 CCAATGGTAGCACATCTAGCAAA No data
Right 1021195656 7:17671728-17671750 CAATTGAAAAAGATTTACAATGG No data
1021195655_1021195661 24 Left 1021195655 7:17671691-17671713 CCAATGGTAGCACATCTAGCAAA No data
Right 1021195661 7:17671738-17671760 AGATTTACAATGGCTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021195655 Original CRISPR TTTGCTAGATGTGCTACCAT TGG (reversed) Intergenic
No off target data available for this crispr