ID: 1021195656

View in Genome Browser
Species Human (GRCh38)
Location 7:17671728-17671750
Sequence CAATTGAAAAAGATTTACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021195654_1021195656 27 Left 1021195654 7:17671678-17671700 CCTAAAGGCTTTACCAATGGTAG No data
Right 1021195656 7:17671728-17671750 CAATTGAAAAAGATTTACAATGG No data
1021195655_1021195656 14 Left 1021195655 7:17671691-17671713 CCAATGGTAGCACATCTAGCAAA No data
Right 1021195656 7:17671728-17671750 CAATTGAAAAAGATTTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021195656 Original CRISPR CAATTGAAAAAGATTTACAA TGG Intergenic
No off target data available for this crispr