ID: 1021196285

View in Genome Browser
Species Human (GRCh38)
Location 7:17678125-17678147
Sequence GGGAAAAATAAAACAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021196283_1021196285 -4 Left 1021196283 7:17678106-17678128 CCATGGCAGTTATCCTGGTGGGA No data
Right 1021196285 7:17678125-17678147 GGGAAAAATAAAACAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021196285 Original CRISPR GGGAAAAATAAAACAACTGA AGG Intergenic
No off target data available for this crispr