ID: 1021197671

View in Genome Browser
Species Human (GRCh38)
Location 7:17690928-17690950
Sequence ATCTGTCAACCCTACAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021197671_1021197673 30 Left 1021197671 7:17690928-17690950 CCAAGATTGTAGGGTTGACAGAT No data
Right 1021197673 7:17690981-17691003 GTGAAAACTTCACCAGCAGAAGG No data
1021197671_1021197672 8 Left 1021197671 7:17690928-17690950 CCAAGATTGTAGGGTTGACAGAT No data
Right 1021197672 7:17690959-17690981 TTTCAACATGTAAAACGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021197671 Original CRISPR ATCTGTCAACCCTACAATCT TGG (reversed) Intergenic
No off target data available for this crispr