ID: 1021202640

View in Genome Browser
Species Human (GRCh38)
Location 7:17742695-17742717
Sequence GGTGCTTGCACTCACCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 2, 1: 1, 2: 6, 3: 24, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021202637_1021202640 -9 Left 1021202637 7:17742681-17742703 CCTTTGTCAGGGCTGGTGCTTGC No data
Right 1021202640 7:17742695-17742717 GGTGCTTGCACTCACCATTGGGG 0: 2
1: 1
2: 6
3: 24
4: 122
1021202636_1021202640 -6 Left 1021202636 7:17742678-17742700 CCACCTTTGTCAGGGCTGGTGCT No data
Right 1021202640 7:17742695-17742717 GGTGCTTGCACTCACCATTGGGG 0: 2
1: 1
2: 6
3: 24
4: 122
1021202629_1021202640 26 Left 1021202629 7:17742646-17742668 CCTCAGTGCATTTCATTAGGAGC No data
Right 1021202640 7:17742695-17742717 GGTGCTTGCACTCACCATTGGGG 0: 2
1: 1
2: 6
3: 24
4: 122
1021202633_1021202640 -1 Left 1021202633 7:17742673-17742695 CCCAGCCACCTTTGTCAGGGCTG No data
Right 1021202640 7:17742695-17742717 GGTGCTTGCACTCACCATTGGGG 0: 2
1: 1
2: 6
3: 24
4: 122
1021202634_1021202640 -2 Left 1021202634 7:17742674-17742696 CCAGCCACCTTTGTCAGGGCTGG No data
Right 1021202640 7:17742695-17742717 GGTGCTTGCACTCACCATTGGGG 0: 2
1: 1
2: 6
3: 24
4: 122
1021202631_1021202640 2 Left 1021202631 7:17742670-17742692 CCTCCCAGCCACCTTTGTCAGGG No data
Right 1021202640 7:17742695-17742717 GGTGCTTGCACTCACCATTGGGG 0: 2
1: 1
2: 6
3: 24
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021202640 Original CRISPR GGTGCTTGCACTCACCATTG GGG Intergenic
900606097 1:3524205-3524227 GGTGCTGGCAGCCACCGTTGTGG + Exonic
908918161 1:69157447-69157469 GGTGCATGCACTTGCCACTGGGG - Intergenic
909173364 1:72322511-72322533 GGTGCCTGCACTTGCCATTGGGG + Intergenic
909657008 1:78043777-78043799 GTTGCCTGGACTCAACATTGTGG + Intronic
911292172 1:96070896-96070918 GGCACATGCACTCACCATTGGGG - Intergenic
911941031 1:104048157-104048179 GGTGCTTGTGCTTGCCATTGGGG - Intergenic
915267934 1:154732106-154732128 GGTCCTTGCACAAACCAATGGGG + Intronic
916022689 1:160807906-160807928 GGTGTTTGCTTTCACCACTGGGG - Intronic
919452305 1:197786942-197786964 TGTCCTTGCACTCACCATGGAGG + Intergenic
920749710 1:208662165-208662187 GGAGCTTAAACTCACCTTTGTGG + Intergenic
923866688 1:237947226-237947248 GATGCTATCACTCACCATCGCGG - Intergenic
1065041963 10:21706300-21706322 GGTGCCTGCACATACCATTAGGG + Intronic
1066620567 10:37345080-37345102 TGTGCAGGCACTCACCACTGGGG - Intronic
1068368073 10:56077538-56077560 GGTGCTTGTACTCATCATTGAGG + Intergenic
1069172951 10:65255390-65255412 GGTGCCTGCACACATCACTGGGG + Intergenic
1075873572 10:125788738-125788760 GGTGCTTCCACTCAGGCTTGAGG + Exonic
1076100065 10:127770091-127770113 GCAGCTTGCCCTCCCCATTGTGG + Intergenic
1079700479 11:23540278-23540300 GGTGCTTCCACTCTTCACTGGGG - Intergenic
1079870580 11:25793863-25793885 GCTGCTTGCACCTACCACTGGGG - Intergenic
1083430543 11:62611913-62611935 GGTCCCTGCCCTCACCAGTGCGG - Intronic
1085045113 11:73348100-73348122 GGGCCTGGCAGTCACCATTGAGG + Intronic
1085844589 11:80050824-80050846 GGTGTTTGCTCACACAATTGTGG - Intergenic
1087198792 11:95325047-95325069 GGTTCCTGCACTTTCCATTGTGG + Intergenic
1090569889 11:128034459-128034481 GGTGCTTGATTTCACCACTGTGG + Intergenic
1097363117 12:58680050-58680072 GGTGCCTGCTCTCACCACTGGGG - Intronic
1098119538 12:67221504-67221526 GGGGCTTTGACTCTCCATTGTGG + Intergenic
1099191948 12:79570014-79570036 GGTGCCGACTCTCACCATTGGGG + Intergenic
1099519445 12:83642338-83642360 GGTGCCTGCACACACCATTATGG - Intergenic
1099859421 12:88208751-88208773 GGTGCCTGCTCTAACTATTGGGG + Intergenic
1099875070 12:88393529-88393551 GGTGCTTCCACTGATCATTGGGG + Intergenic
1099917680 12:88915502-88915524 GGTGCATGCACACAACATTAGGG - Intergenic
1102764840 12:115423450-115423472 TTTGCCTGCACTCATCATTGAGG + Intergenic
1105211395 13:18259129-18259151 GGTGCGACCACTCACCTTTGAGG + Intergenic
1109503987 13:63274590-63274612 GGTGCTTGCATTCACTACTGGGG + Intergenic
1109842898 13:67944277-67944299 TGTGCTTGCACTCTCAAATGTGG + Intergenic
1110337074 13:74345398-74345420 GGTGCATGCACTCACTTTTGGGG - Intergenic
1111041796 13:82758018-82758040 GGTGCTTGTGCTTGCCATTGGGG + Intergenic
1112056810 13:95696525-95696547 GATGCTGTCACTCACCATTGTGG + Intronic
1112142679 13:96663087-96663109 GGTGCCTGTACTCATCACTGGGG - Intronic
1112341518 13:98556566-98556588 GGTGTTGTTACTCACCATTGGGG - Intronic
1113224087 13:108140246-108140268 GGTGCTTGCACACAGCATCCTGG - Intergenic
1116332189 14:43611348-43611370 GGTGCTTGTACCTGCCATTGCGG - Intergenic
1117623025 14:57607512-57607534 GGAGCTGGGACTCATCATTGTGG - Intronic
1119147208 14:72328175-72328197 GATGCTTGCCCACACCAGTGAGG + Intronic
1120121099 14:80680820-80680842 GGTGCTTGTGTTTACCATTGGGG + Intronic
1131585159 15:93684840-93684862 GGTGCTTGCACCTGCCACTGAGG + Intergenic
1132334522 15:101037480-101037502 GGTACCTGTACACACCATTGAGG - Intronic
1134843800 16:17423212-17423234 GGTGCTTTCACTGCCCAGTGGGG + Intronic
1135596079 16:23744372-23744394 GGGTCTTACACTCACCCTTGTGG - Intergenic
1138920551 16:61523373-61523395 GGTGCTTGCACTTCACATAGTGG + Intergenic
1142182015 16:88675869-88675891 GGTCCTTGCACTCAGCGCTGAGG - Intergenic
1143438758 17:6951552-6951574 GGTGGTTTCACTCACCTGTGTGG - Intronic
1145043989 17:19597882-19597904 GATGCTATCACTCACCATTGCGG + Intergenic
1146744051 17:35313064-35313086 GGTGCCTGCACTCACTACTGGGG - Intergenic
1149987897 17:61361937-61361959 GAAGATTGCCCTCACCATTGTGG - Intronic
1151258322 17:72897093-72897115 AGTGCTCTCACTCACCCTTGAGG - Intronic
1161906818 19:7163017-7163039 GCTGCCTGCACTCACCTTTGAGG + Exonic
1168018616 19:53593304-53593326 GGTGCCTGCCTTCATCATTGGGG - Intergenic
926332183 2:11834790-11834812 GGTGCTTGCACTCTGCATGACGG + Intergenic
929825230 2:45304855-45304877 GGTGCTTAAAGTCACCATTAAGG + Intergenic
930094595 2:47557401-47557423 GTTGATTTCACTCACCATTCTGG - Intronic
930126861 2:47805819-47805841 AGAGCACGCACTCACCATTGTGG + Intronic
930419931 2:51137932-51137954 TTTGCTTGCAGTCATCATTGAGG + Intergenic
930549546 2:52815168-52815190 GGTGCTTGTACTTGCCATTGGGG - Intergenic
931063154 2:58554100-58554122 GCTGCTTGCTGTCACCACTGGGG + Intergenic
931535523 2:63271568-63271590 GGTGCCTACATGCACCATTGTGG + Intronic
937218444 2:120327470-120327492 GGTGATTCCACTGACCATGGGGG + Intergenic
937419534 2:121742208-121742230 GGGGCTTGCAGTCCTCATTGTGG + Intronic
937778626 2:125811164-125811186 GATGCTGTCACTCACCATCGCGG + Intergenic
945305045 2:208252043-208252065 AATGCTAGCACTCACCATTCTGG - Intronic
947780234 2:232753655-232753677 CGTGCTTGCAGTCACCCGTGAGG + Intronic
947940318 2:234048594-234048616 GGTGTTTGCTCACACAATTGTGG - Intergenic
1174796290 20:53525216-53525238 GGTGGCTGCACTCACTATTGGGG - Intergenic
1177893350 21:26833379-26833401 GCTGCTTGTACTCACAAGTGGGG + Intergenic
1180637138 22:17270156-17270178 GGTGCTTGCAGTCACCGTCTGGG + Intergenic
1180764838 22:18340309-18340331 GGTGCGACCACTCACCTTTGAGG - Intergenic
1180814192 22:18779375-18779397 GGTGCGACCACTCACCTTTGAGG + Intergenic
1180908327 22:19431425-19431447 CCTGCGCGCACTCACCATTGTGG + Exonic
1181200377 22:21213710-21213732 GGTGCGACCACTCACCTTTGAGG + Exonic
1181701360 22:24623249-24623271 GGTGCGACCACTCACCTTTGAGG - Exonic
1185051120 22:48554883-48554905 GGTGCTTCCTCTCCCCATAGTGG + Intronic
1185162333 22:49237562-49237584 GGAGCCTGCATTCACCAATGTGG - Intergenic
1203226460 22_KI270731v1_random:81214-81236 GGTGCGACCACTCACCTTTGAGG - Intergenic
1203264290 22_KI270734v1_random:5062-5084 GGTGCGACCACTCACCTTTGAGG + Intergenic
951299255 3:20974428-20974450 GGTGCTTGCACCCGACACTGGGG - Intergenic
951473973 3:23085242-23085264 GGTGCTTCCAATCACCTTTGTGG - Intergenic
951999765 3:28772145-28772167 GCAGCTTGCACTCTCCAGTGTGG - Intergenic
952232764 3:31448460-31448482 AGTCCATGCACTCATCATTGGGG + Intergenic
952847542 3:37701015-37701037 GGTGCTGGAACTCATCACTGAGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955482291 3:59402007-59402029 GGTGCCTGGACTCCCCATTCTGG + Intergenic
955976356 3:64484212-64484234 GGTGCTCTCACTCACACTTGGGG - Intergenic
958826985 3:99042052-99042074 GGTGCCTACTGTCACCATTGGGG + Intergenic
959691923 3:109207016-109207038 GGTGCTTCCTCACAGCATTGTGG - Intergenic
961306052 3:125959576-125959598 GGGGCTTCCACTAACCACTGGGG - Intergenic
962084368 3:132174487-132174509 GGTGCCCGCACTCACCATGGGGG + Intronic
962889394 3:139657984-139658006 GGGGCATGCACTTACCATTTTGG - Intronic
962930826 3:140034456-140034478 GGGGCTTGTACTCCCCATAGAGG + Intronic
963489652 3:145983593-145983615 GGTGCCTGCACTTACCATTGGGG + Intergenic
963912439 3:150826321-150826343 GGTCCCTGCATTCACCCTTGGGG + Intergenic
965532411 3:169786219-169786241 GGTGCTTGAACTTAACCTTGAGG + Intronic
966076428 3:175940913-175940935 GTTGCTTGTACCTACCATTGGGG + Intergenic
967635780 3:191801514-191801536 GGTTCCTGAATTCACCATTGGGG + Intergenic
967667978 3:192197592-192197614 AGTGCCTGAACTCACCAATGAGG + Intronic
968709415 4:2102169-2102191 GGTGCATGCACTTTCCACTGGGG + Intronic
979100220 4:116603679-116603701 TGTGCTGGTACTCACCATTCAGG + Intergenic
981076248 4:140595350-140595372 GGTGCCTGCACTTGCCACTGGGG - Intergenic
982269979 4:153576345-153576367 GGTGCTAGAACTCCCCCTTGTGG + Intronic
983580296 4:169303087-169303109 GTTGATTGCCCTCCCCATTGTGG - Intergenic
989214827 5:38892933-38892955 AGTGCTTGTGCTCACCATTGGGG + Intronic
993779668 5:92050950-92050972 GGTGCTTGTACTTGCCACTGGGG - Intergenic
994289319 5:98009467-98009489 AGTGCCTGCACTTACCATTTAGG + Intergenic
994405084 5:99335065-99335087 GGTGCTTGTGCCCACCACTGGGG + Intergenic
995099293 5:108278822-108278844 GGTGCATGCACTTGCCACTGGGG + Intronic
995946891 5:117658837-117658859 GAGGTTTGGACTCACCATTGTGG + Intergenic
996124471 5:119708307-119708329 GGTGCATGCTTTCACCATTGTGG - Intergenic
1000067725 5:157709980-157710002 GGTCCTTGCTCTAACAATTGAGG - Intergenic
1001529070 5:172449648-172449670 GGTGCTTGTTCACACCAGTGAGG - Intronic
1005834124 6:29695095-29695117 GCTGCCTGTGCTCACCATTGTGG - Intergenic
1009538907 6:64925855-64925877 GGTGCTTGCACCCACCATTAGGG - Intronic
1010547302 6:77173838-77173860 GGTGCTTGCACCAGCCATTGGGG - Intergenic
1011321863 6:86104468-86104490 GATGCTTGCACTTTCCATTAGGG - Intergenic
1013691751 6:112652835-112652857 GTTGCTTGCTCTCACCAGAGTGG - Intergenic
1016110583 6:140218804-140218826 GGTGTGTGCACTTGCCATTGGGG - Intergenic
1021202640 7:17742695-17742717 GGTGCTTGCACTCACCATTGGGG + Intergenic
1021765478 7:23944046-23944068 GGTGCCTGCTGCCACCATTGGGG + Intergenic
1022907816 7:34873481-34873503 GGTGCTGGCACCCACCTCTGGGG + Intronic
1024539880 7:50467677-50467699 GGTGCCAGCGCTCACCACTGCGG + Intronic
1025018734 7:55464172-55464194 AGTGCCTGCACACACCATCGTGG - Intronic
1025098488 7:56116065-56116087 GGCGCTTGCGCTGGCCATTGAGG + Exonic
1027715116 7:81659739-81659761 GGTGCTTGTGCTCACCATTGGGG + Intergenic
1028041224 7:86057700-86057722 GGTGCCTGCACTTGCCATTGAGG - Intergenic
1035916541 8:3630752-3630774 GGTGGTAGCACTCACCATGGTGG + Intronic
1037299385 8:17435077-17435099 TGTTCTTGCACTCACCCTTGGGG + Intergenic
1040377107 8:46836791-46836813 GGTGCTATCACTCACCATCGCGG - Intergenic
1040413468 8:47178238-47178260 TGTGTTTGCACTCACCAATCTGG + Intergenic
1046114050 8:109764623-109764645 GGTGATGGCACGCACCCTTGGGG + Intergenic
1048681264 8:136843803-136843825 GGTGCCTGCACTCACCATTTGGG + Intergenic
1049056317 8:140240058-140240080 GATGCTTCCACTTATCATTGTGG - Intronic
1051314484 9:15813341-15813363 GGGTCTTGCAATCACCATTTAGG + Intronic
1059149578 9:111937418-111937440 GCTGCCTGCACACCCCATTGCGG + Intergenic
1059338610 9:113584373-113584395 GGTGCATGGAGCCACCATTGCGG - Exonic
1187628386 X:21141962-21141984 GCTGCTTGCATGCACCACTGAGG - Intergenic
1188712396 X:33416367-33416389 GGTGCTTGTACTCACCATTGGGG + Intergenic
1189073816 X:37894724-37894746 GAAGCTTGCTCTCACCAATGTGG + Intronic
1189100751 X:38186817-38186839 TGTCCTTCCACTCACCTTTGGGG - Intronic
1190966645 X:55307495-55307517 GGTGCTTGTACTTGCCACTGGGG - Intergenic
1191178154 X:57529037-57529059 GGTGCCTGCACTTACCACTGGGG - Intergenic
1191642073 X:63436792-63436814 GGTGCTTTAATCCACCATTGAGG + Intergenic
1193269911 X:79516617-79516639 GATGCCTGCAGTCACCATTCGGG + Intergenic
1193675573 X:84448026-84448048 AGTGCCTGCATACACCATTGAGG + Intronic
1195786316 X:108527661-108527683 GGTGCTTGCACTCACCATTGGGG + Intronic
1200698672 Y:6383673-6383695 GCTGCCTGCACTCCACATTGTGG - Intergenic
1201035442 Y:9781026-9781048 GCTGCCTGCACTCCACATTGTGG + Intergenic
1202096859 Y:21260311-21260333 GGTGCATGCACTCACCATTAGGG + Intergenic