ID: 1021207184

View in Genome Browser
Species Human (GRCh38)
Location 7:17796856-17796878
Sequence CGAATGAGAACAAGAGTAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021207184_1021207186 25 Left 1021207184 7:17796856-17796878 CCTGCTACTCTTGTTCTCATTCG 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1021207186 7:17796904-17796926 GCCTCTGCTAAAATGCCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 144
1021207184_1021207185 -2 Left 1021207184 7:17796856-17796878 CCTGCTACTCTTGTTCTCATTCG 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1021207185 7:17796877-17796899 CGAATACTTTTATCTCTGCATGG 0: 1
1: 0
2: 0
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021207184 Original CRISPR CGAATGAGAACAAGAGTAGC AGG (reversed) Exonic
903233227 1:21934275-21934297 CAGATGAGAGCAAGGGTAGCAGG + Intronic
906799009 1:48719966-48719988 CCCATGAGAACAAGAGAAGAAGG + Intronic
909004958 1:70265036-70265058 TGAATGAGAGGAAGATTAGCAGG + Intronic
910986648 1:93011583-93011605 CAAAGCAGAACAAGAGAAGCAGG + Intergenic
912302813 1:108535299-108535321 CAAATGAGGACAAGAGTGGTAGG - Intergenic
917791871 1:178504231-178504253 CGAATGAGAGCAGGAGGAGGTGG + Intergenic
918111342 1:181457812-181457834 CGCATGACAAAAAGAGTAACTGG + Intronic
919015685 1:192031494-192031516 AGAGTGAGAAGAAGAGAAGCAGG - Intergenic
924435111 1:244032596-244032618 GGAATAAGAAGAACAGTAGCTGG + Intergenic
1063622196 10:7659683-7659705 TCAAGGAGAACAAGAGAAGCTGG + Intronic
1063879033 10:10511838-10511860 ATAAAGAAAACAAGAGTAGCAGG - Intergenic
1064100321 10:12458049-12458071 TGAATGAGACCAAGAGCAGGTGG + Intronic
1067276503 10:44839631-44839653 AGAATGAGAACAACAGTGCCAGG + Intergenic
1067552361 10:47244855-47244877 TGGATGAGAACATGAGTGGCAGG - Intergenic
1068163707 10:53300888-53300910 TGAATGAGAAAAAGAGTAGGAGG - Intergenic
1069378673 10:67819895-67819917 CGACTGTGAACAAGACAAGCAGG + Intronic
1072915722 10:99536312-99536334 CGAATGAGATCAAAAGTTGGGGG + Exonic
1074846445 10:117403025-117403047 CAAATGAGAACAAAATTTGCTGG - Intergenic
1078881399 11:15452539-15452561 CTCATGAGACCAAGGGTAGCTGG + Intergenic
1079277952 11:19059228-19059250 AGAAAGAGTACAGGAGTAGCTGG - Intronic
1080887942 11:36383602-36383624 AGAACGTGAACAAGATTAGCGGG - Intronic
1085597248 11:77821005-77821027 GGAATGAAAACAAGGGAAGCGGG + Exonic
1087540858 11:99517721-99517743 GGACAGAGAACAAGGGTAGCAGG - Intronic
1088438391 11:109841137-109841159 AGAAAGAGAACAAGAGAAGAAGG + Intergenic
1090532277 11:127603312-127603334 CAAAAGAGATCAAGTGTAGCAGG - Intergenic
1091202706 11:133794333-133794355 CAAATGGGAACAAGGGCAGCAGG + Intergenic
1097614213 12:61864028-61864050 AGAATGAGAGCAAGTGAAGCAGG - Intronic
1098183659 12:67874658-67874680 GGAATGAGGACTGGAGTAGCTGG - Intergenic
1100993776 12:100280073-100280095 AGAAAGAGAACAAGAGAACCAGG - Intronic
1104404185 12:128503991-128504013 GGAGTGAGAACGAGAGAAGCAGG + Intronic
1105833951 13:24192401-24192423 AGGAGGAGAACTAGAGTAGCAGG - Intronic
1111578694 13:90194003-90194025 TGAATAAGAAAAAGAATAGCGGG - Intergenic
1111849731 13:93557565-93557587 AGAATGAGAACAAGCCTGGCTGG - Intronic
1112379189 13:98872566-98872588 CAAATGTGAACAAAATTAGCTGG - Intronic
1114953460 14:27787042-27787064 AGAATGAGAACTAGATTAGCCGG + Intergenic
1122007976 14:98721471-98721493 ATAATGATAACAACAGTAGCAGG + Intergenic
1127204795 15:56704217-56704239 GGAATGTGAAGAAGAGGAGCTGG - Exonic
1127702575 15:61515255-61515277 CGAATGAGACCAAGAGTATAAGG + Intergenic
1129657633 15:77534812-77534834 TGAATGAAAACAAGAGTATTGGG + Intergenic
1131358394 15:91766562-91766584 CACATGAGCACAAGAGTGGCAGG - Intergenic
1132005161 15:98219745-98219767 TGAATGAGAACATGTGCAGCAGG + Intergenic
1137470537 16:48752313-48752335 TGAATGAGAACAAGACAAGGAGG + Intergenic
1141894755 16:86952236-86952258 CGAATGAGGAAACGAGAAGCAGG + Intergenic
1143204060 17:5130950-5130972 CAAGTGAGCACAAGAGGAGCGGG + Intronic
1143261424 17:5601536-5601558 AAAATGAGCACAAGAGGAGCTGG - Intronic
1146844510 17:36174449-36174471 CAAGTGAGCACAAGAGGAGCGGG - Intronic
1146856814 17:36262384-36262406 CAAGTGAGCACAAGAGGAGCGGG - Intronic
1146863803 17:36325991-36326013 CAAGTGAGCACAAGAGGAGCGGG + Intronic
1146872724 17:36386294-36386316 CAAGTGAGCACAAGAGGAGCGGG - Intronic
1146880083 17:36437380-36437402 CAAGTGAGCACAAGAGGAGCGGG - Intronic
1147066664 17:37926579-37926601 CAAGTGAGCACAAGAGGAGCGGG + Intronic
1147075607 17:37986919-37986941 CAAGTGAGCACAAGAGGAGCGGG - Intronic
1147078196 17:38006140-38006162 CAAGTGAGCACAAGAGGAGCGGG + Intronic
1147087132 17:38066465-38066487 CAAGTGAGCACAAGAGGAGCGGG - Intronic
1147094132 17:38130075-38130097 CAAGTGAGCACAAGAGGAGCGGG + Intergenic
1147103077 17:38190428-38190450 CAAGTGAGCACAAGAGGAGCGGG - Intergenic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1149847655 17:60016894-60016916 CAAGTGAGCACAAGAGGAGCTGG - Intergenic
1150086012 17:62273511-62273533 CAAGTGAGCACAAGAGGAGCGGG - Intronic
1151430952 17:74062713-74062735 TGGATGAGGACAAGAGTATCTGG + Intergenic
1156062902 18:33102636-33102658 CTAATGTGAACAACAGTACCAGG - Intronic
1156869179 18:41925459-41925481 GGAATGAGAAGAAGAGAATCAGG + Intergenic
1159995776 18:74962532-74962554 GGAATGAGCCCAAGAGTGGCGGG - Intronic
1160089782 18:75816046-75816068 TGGAAGAGAACAAGAGGAGCTGG - Intergenic
1161598818 19:5167547-5167569 GGTATGGGAAAAAGAGTAGCAGG + Intronic
926373220 2:12201544-12201566 CCAATGTTAACAAGAATAGCAGG + Intergenic
932591185 2:73068900-73068922 AGAATGGGAACAAGAGTTGGGGG + Intronic
934483848 2:94682195-94682217 AGAAAGAGAACTAGATTAGCCGG - Intergenic
935708951 2:105880739-105880761 CAAAAGATAACAAGAGTAGGTGG - Intronic
937810082 2:126189466-126189488 AGAAAGAAAACAAGAGTAGAGGG + Intergenic
938378394 2:130823313-130823335 CCAATGAGGATGAGAGTAGCAGG + Intergenic
948409496 2:237748155-237748177 CAAATGAGGACAAGAGAAGAAGG + Intronic
1169542667 20:6617402-6617424 GGAATCAGAACAAGAGGAACTGG + Intergenic
1171456905 20:25277316-25277338 CAAATGATAACGTGAGTAGCTGG + Exonic
1172253853 20:33499263-33499285 GGAATGAGAACAAAATTGGCAGG - Intronic
1173284811 20:41660732-41660754 GGAGTGAGAGGAAGAGTAGCAGG - Intergenic
1177418236 21:20822454-20822476 CAAATGTGAACAAGATGAGCTGG - Intergenic
950838434 3:15942942-15942964 TGAATGAGACAAAGACTAGCAGG - Intergenic
955448653 3:59042546-59042568 CGAACGAGAAAAAGAGTAATAGG + Intronic
955618697 3:60837416-60837438 CAAAGGAAAACAAGAGTAGCTGG - Intronic
955925011 3:63995990-63996012 GGAATGAGAAGAAGAGGAGGAGG - Exonic
957810326 3:85214246-85214268 GGAAAGAGAACAAGAGTCTCTGG - Intronic
960464798 3:117984307-117984329 CAAATGAGCACAGGAGTAACTGG + Intergenic
965961880 3:174439364-174439386 TTAATGAGAATAAGAGTAGTTGG - Intronic
966382073 3:179354481-179354503 TGAATGAGAACAGGGGTAGGAGG + Intronic
967874892 3:194261631-194261653 CTCAGGAGAACAAGAGGAGCCGG + Intergenic
969682410 4:8650658-8650680 CGAATGAGCACAGGAGTGGAAGG - Intergenic
970156909 4:13151176-13151198 AGAAAGAGAGCAAGAGCAGCAGG - Intergenic
975474502 4:74807802-74807824 CCAAGGAGAACAAAAGGAGCAGG + Intergenic
978463738 4:108985263-108985285 CAAGTGAGAAAAAGAGTAACTGG - Intronic
978991731 4:115091453-115091475 CAATTGAGAAGAAGAGTAGATGG - Intronic
980216708 4:129861418-129861440 CGAATAAGAATGAAAGTAGCAGG - Intergenic
981283227 4:142985037-142985059 CCACTGAGAACAAAAGCAGCAGG + Intergenic
981483226 4:145259105-145259127 GGAATGAGAACAAGAGGTGGGGG + Intergenic
986225243 5:5806191-5806213 CCAATGAGAACAAGGCTAACAGG + Intergenic
991636641 5:68712628-68712650 CCTTTGAGAAAAAGAGTAGCCGG + Intergenic
992595890 5:78347125-78347147 CCAATGAGGACAAGAGTTGGTGG + Intergenic
997462722 5:134065066-134065088 AGAATTAGAAAAAGAGTAACAGG - Intergenic
997807033 5:136928188-136928210 GGACAGAGAACAAGAGTTGCAGG - Intergenic
997841668 5:137246706-137246728 AGAATGAGATCTAGAGTAGTGGG - Intronic
998374418 5:141681739-141681761 CGACAGAGCACAAGAGTAACAGG - Intronic
1005476200 6:26210360-26210382 GGAAGGAGAGGAAGAGTAGCGGG - Intergenic
1006886152 6:37383929-37383951 CGAATGAGAACAGAAGAAACGGG - Intronic
1009442187 6:63694145-63694167 ATAATTAGAACCAGAGTAGCAGG + Intronic
1009442288 6:63695485-63695507 GTAATTAGAACAAGAGTAGCAGG + Intronic
1010140277 6:72606269-72606291 CAGATGAGAACAACAGTAGCTGG - Intergenic
1010421384 6:75680449-75680471 AGAATGAGAAAAAGAGTATACGG + Intronic
1010924094 6:81722202-81722224 AAAATGACAACAACAGTAGCAGG + Intronic
1010940222 6:81907939-81907961 AGAATGAGAATAATAGAAGCAGG - Intergenic
1013154963 6:107484436-107484458 AGAATGAGAAGAAGAGTGGCAGG - Intergenic
1021207184 7:17796856-17796878 CGAATGAGAACAAGAGTAGCAGG - Exonic
1022566483 7:31407774-31407796 CGAATGAGAAAAAGAGATGTCGG - Intergenic
1028213284 7:88101367-88101389 AGCAGGAGAACAAGAGTTGCAGG + Intronic
1028343772 7:89755113-89755135 CCAATGTGTACAAGAATAGCAGG + Intergenic
1029506802 7:100967885-100967907 GGAATGAGAGCAAGAGAAACGGG - Exonic
1030561384 7:111091240-111091262 CGACTGAGAAAAAGAGTTCCAGG + Exonic
1032313812 7:130815188-130815210 ATAATTAGAACAAGAGTAGCAGG + Intergenic
1034300353 7:150009858-150009880 AGAGTGAGAGCAAGCGTAGCTGG - Intergenic
1034805700 7:154087450-154087472 AGAGTGAGAGCAAGCGTAGCTGG + Intronic
1041862876 8:62534169-62534191 CGTATGGGAACAAGCCTAGCCGG - Intronic
1046160510 8:110357014-110357036 CTGATGATAACCAGAGTAGCTGG - Intergenic
1053194111 9:36101955-36101977 CAAAAGAGAACAAGAGTCACAGG - Intronic
1053673936 9:40402191-40402213 AGAATGAGAACTAGATTAGCTGG + Intergenic
1053923739 9:43028558-43028580 AGAATGAGAACTAGATTAGCTGG + Intergenic
1054385039 9:64542257-64542279 AGAATGAGAACTAGATTAGCTGG + Intergenic
1054510690 9:65974099-65974121 AGAATGAGAACTAGATTAGCTGG - Intergenic
1055438157 9:76313118-76313140 CCAATGAGGAAAAGAATAGCAGG + Intronic
1055473838 9:76641908-76641930 AGAATGAGGAGAAGAGTTGCTGG - Intronic
1056424562 9:86464280-86464302 GGAAAGAGAACAAGAGTCTCTGG - Intergenic
1056463939 9:86835806-86835828 AGAATGAGAAAGACAGTAGCCGG + Intergenic
1057474297 9:95385617-95385639 AGAATGAGAACAAGAGGACAGGG - Intergenic
1058915300 9:109559124-109559146 GGAATGAGAGCAAGAGGAGACGG - Intergenic
1193555674 X:82951205-82951227 GGAAAGAGAACAAGAGTCTCTGG - Intergenic
1193847130 X:86486568-86486590 CGTAAGAGAACCAGAATAGCAGG - Intronic