ID: 1021207664

View in Genome Browser
Species Human (GRCh38)
Location 7:17805132-17805154
Sequence TTGAAAAACATGACCACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021207659_1021207664 19 Left 1021207659 7:17805090-17805112 CCAGAATAAAACCAAAGAACAGA 0: 1
1: 0
2: 3
3: 66
4: 582
Right 1021207664 7:17805132-17805154 TTGAAAAACATGACCACTGGTGG 0: 1
1: 0
2: 2
3: 20
4: 229
1021207661_1021207664 8 Left 1021207661 7:17805101-17805123 CCAAAGAACAGAAACTGGCTTGA 0: 1
1: 0
2: 1
3: 17
4: 226
Right 1021207664 7:17805132-17805154 TTGAAAAACATGACCACTGGTGG 0: 1
1: 0
2: 2
3: 20
4: 229
1021207658_1021207664 20 Left 1021207658 7:17805089-17805111 CCCAGAATAAAACCAAAGAACAG 0: 1
1: 0
2: 1
3: 50
4: 566
Right 1021207664 7:17805132-17805154 TTGAAAAACATGACCACTGGTGG 0: 1
1: 0
2: 2
3: 20
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021207664 Original CRISPR TTGAAAAACATGACCACTGG TGG Intronic
901210380 1:7521358-7521380 TTGCAAAATGTTACCACTGGGGG - Intronic
901388784 1:8929016-8929038 TTGGAAAACAAGACATCTGGTGG + Intergenic
902425131 1:16314792-16314814 GTGAATAACATGACCCCGGGAGG + Intronic
904989903 1:34583968-34583990 TTGAAAAACATGAGCATAAGAGG + Intergenic
904992813 1:34607433-34607455 TTGAAAAATATTACCACTTGGGG - Intergenic
906694861 1:47817183-47817205 ATGGAAAACATGGCCTCTGGAGG - Intronic
908173807 1:61534038-61534060 TTGCAAAACATGACCAGGTGTGG + Intergenic
908830581 1:68174548-68174570 TGGAAAACCATGACCCTTGGTGG + Intronic
912363210 1:109112214-109112236 GTGTAAAGCATGACCTCTGGTGG + Intronic
913110325 1:115651726-115651748 ATGAAAAACATTTCCACTGCAGG - Intronic
913685046 1:121223579-121223601 TGGAAAAGAATGTCCACTGGTGG - Intronic
914036891 1:144011183-144011205 TGGAAAAGAATGTCCACTGGTGG - Intergenic
914152563 1:145056748-145056770 TGGAAAAGAATGTCCACTGGTGG + Intronic
914697507 1:150098685-150098707 TTGCAAAACCAGAACACTGGTGG + Intronic
915859087 1:159422812-159422834 GTGAAAATGAGGACCACTGGGGG + Intergenic
917049061 1:170897782-170897804 TTGAGAAGTGTGACCACTGGTGG - Intergenic
917986727 1:180327157-180327179 TTGATAAACCTCACCACTGCGGG - Intronic
919601125 1:199623829-199623851 TTAAAAAAAATTACCCCTGGGGG - Intergenic
921470428 1:215541788-215541810 TTGAACAACCTTACCCCTGGAGG + Intergenic
921921227 1:220672422-220672444 TTGAAAAAATTGTCCACTGTGGG - Intergenic
922994364 1:229944213-229944235 TTGAAGAACAAGACATCTGGAGG + Intergenic
923865296 1:237933148-237933170 ATGGAGAAGATGACCACTGGTGG - Intergenic
1063422944 10:5928101-5928123 AAGAAATACATGACCACTGCTGG - Intronic
1064826587 10:19409653-19409675 TTGAAAGACATTACCATTGGGGG + Intronic
1065790780 10:29258576-29258598 TAGAAAAAAACGACCAGTGGGGG + Intergenic
1066470401 10:35692215-35692237 TTGACAAACAAGTCCCCTGGTGG - Intergenic
1067680532 10:48434787-48434809 GAGAAAAAAATTACCACTGGAGG + Intronic
1068193886 10:53690538-53690560 TTGAAAAACATGAGTAATCGGGG + Intergenic
1069343345 10:67438918-67438940 TTGACAAACATCACCACTGCGGG + Intronic
1078905139 11:15678468-15678490 TTATTAAACATGACCAATGGGGG + Intergenic
1080787906 11:35492833-35492855 TTTAAAAACATGGCCTCTTGAGG + Intronic
1080813665 11:35732244-35732266 GTGAACAACATTTCCACTGGTGG + Intronic
1081993486 11:47349850-47349872 TTGAACCACTTGACCACAGGCGG + Exonic
1083533316 11:63445389-63445411 GTGAAAAACATGGAAACTGGAGG - Intergenic
1084449153 11:69222917-69222939 TTGAAAGACGTTACCATTGGGGG - Intergenic
1086155109 11:83656915-83656937 ATGAAAAACGTGACTATTGGAGG - Intronic
1090315818 11:125787310-125787332 TAGAAAACCATGACCACTCCTGG - Intergenic
1091902106 12:4152802-4152824 CTGTAAAACAGGACCAGTGGAGG - Intergenic
1092962023 12:13605404-13605426 TTGAAAAAGATGAACAGTTGTGG + Intronic
1094616609 12:32041984-32042006 GTGCAACACAGGACCACTGGTGG - Intergenic
1094744132 12:33323796-33323818 GTGAAAAACAAGAGCACTTGTGG - Intergenic
1095399420 12:41797282-41797304 ATGAAAAACATGAACATTGCGGG - Intergenic
1097246248 12:57609313-57609335 TTGAAACACTTGGCCAGTGGGGG - Exonic
1098092378 12:66917819-66917841 TTGAAAATTATGAACACTAGAGG - Intergenic
1098580942 12:72098318-72098340 TTGCAAGATTTGACCACTGGGGG - Intronic
1099522110 12:83676901-83676923 GTAAATTACATGACCACTGGAGG + Intergenic
1099776566 12:87139307-87139329 TTGCAAAATATTACCAGTGGGGG - Intergenic
1099924907 12:89005598-89005620 ATGAAATTCATGACCACTAGAGG + Intergenic
1100194520 12:92229091-92229113 TTGCAAAACATGCCAAATGGTGG - Intergenic
1100393893 12:94168042-94168064 TTGAAAGACATAAACACTGTTGG + Intronic
1100474289 12:94921568-94921590 AGGAAAAACATGACATCTGGTGG + Intronic
1102347154 12:112167587-112167609 TTGAAACACATGTTCCCTGGCGG - Intronic
1103324292 12:120110151-120110173 TTGGAAAAAATGACCTGTGGGGG + Intronic
1104802394 12:131563090-131563112 TTGATAAACATGAACAAAGGTGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108380187 13:49847620-49847642 GTAAAAAAGATGACCAGTGGAGG + Intergenic
1110971238 13:81764361-81764383 TTGAAAAACAGTCACACTGGGGG + Intergenic
1111198015 13:84898626-84898648 CTGTAACACATGCCCACTGGGGG - Intergenic
1111544726 13:89717538-89717560 TTTAAAAATTTGACCACTGTGGG - Intergenic
1113539974 13:111099399-111099421 TTGAAAAATATAGGCACTGGAGG + Intergenic
1116184344 14:41577701-41577723 TGGAATAACATGTCCACAGGGGG + Intergenic
1116310430 14:43318522-43318544 TTGAAAAAATTGACCAAAGGGGG + Intergenic
1118826760 14:69390263-69390285 TTGAAAAAGAAAAACACTGGAGG + Intronic
1118867744 14:69716784-69716806 TTGAAACAAATGACTACTGAGGG - Intergenic
1119636625 14:76278571-76278593 TAGGAAAACATGAGCAGTGGTGG + Intergenic
1120321947 14:82974661-82974683 TTGAAAAGTATAACCACTAGGGG + Intergenic
1121735341 14:96214167-96214189 ATGGAAAACATGAGGACTGGCGG - Intronic
1126192317 15:45890875-45890897 TTGAACAAAAAAACCACTGGAGG + Intergenic
1127425783 15:58854646-58854668 TTGAGAAACAAAACCACAGGAGG + Exonic
1131365903 15:91839408-91839430 TTGAAAAACATGTTCATTAGTGG - Intergenic
1131394029 15:92072438-92072460 TTGAAAACCACTACCCCTGGTGG - Intronic
1133186083 16:4099729-4099751 TTGAAAAAAATCACCTTTGGAGG + Intronic
1133885829 16:9826842-9826864 CTAAATAACATGACCACTTGTGG - Intronic
1135184258 16:20301152-20301174 GTGAAAACCATGATGACTGGTGG + Intergenic
1135285812 16:21191980-21192002 TTCAAAAACATATACACTGGGGG + Intergenic
1137337140 16:47561011-47561033 TTTAAAAACATGATCCATGGTGG + Intronic
1140076294 16:71701700-71701722 TTGGAAAGCAAGACCACAGGTGG - Intronic
1141029303 16:80573905-80573927 TTGAAAAAAATGACCCCCAGAGG + Intergenic
1144097993 17:11919141-11919163 TGAAAAAACATGCCCTCTGGTGG - Intronic
1145276669 17:21435515-21435537 TTGAAAAACAAGGCCAGGGGAGG + Intergenic
1145712961 17:26993379-26993401 TTGAAAAACAAGGCCAGGGGAGG + Intergenic
1146050547 17:29549000-29549022 TTTGTAAACATGGCCACTGGGGG - Exonic
1146819857 17:35976123-35976145 TTTAACAACATGGCCACTGGGGG + Intergenic
1147289722 17:39432051-39432073 TTGAAAAATATGACCAAGCGGGG + Intronic
1148082314 17:44974180-44974202 GTGAAGAATATGGCCACTGGAGG + Intergenic
1148517903 17:48239116-48239138 TTTAAAAATATGAACACTTGGGG + Intronic
1150172880 17:63018570-63018592 TTGTAAGAGATTACCACTGGGGG - Intronic
1150304502 17:64072883-64072905 TTGTAAAGCATGATCTCTGGTGG + Intronic
1150483657 17:65529730-65529752 ATTAAAAACATGACCACTCTTGG - Exonic
1150974871 17:70074211-70074233 TTTAAAAGCATGAACACTTGAGG - Intronic
1151580666 17:74976217-74976239 TTTAAAAACATAATTACTGGTGG - Intergenic
1156411272 18:36829676-36829698 TTAAAATACATCATCACTGGAGG - Intronic
1157643669 18:49244373-49244395 TTTAAAAACATGTCAACAGGGGG + Intronic
1159451860 18:68612526-68612548 TTGTAGAACATGAGCAATGGAGG + Intergenic
1159527508 18:69612050-69612072 TTGCAAAATGTTACCACTGGGGG + Intronic
1160249357 18:77187748-77187770 TTGAAAAATGTTACCACTGGGGG - Intergenic
1161024144 19:2027604-2027626 TTGCAAAATGTTACCACTGGGGG + Intronic
1162669569 19:12243957-12243979 TTGAAAAAAATGTCCACTCAGGG + Intronic
1165742740 19:38213321-38213343 TTTAAAGCCATGACCACTGCTGG - Intronic
1167055296 19:47107026-47107048 TTGCAAAAGATGAACACAGGAGG + Intronic
926260343 2:11254539-11254561 TGGTAAAACATAAACACTGGAGG + Intronic
928190000 2:29155519-29155541 TTGCAAAACATTACCTTTGGAGG + Intronic
928381742 2:30823973-30823995 TTGAAAAACATGGCAACCAGTGG - Intergenic
928523848 2:32119026-32119048 TTGAATAACCTGACCTCAGGAGG + Intronic
929226720 2:39518591-39518613 TTGAGATACCTGGCCACTGGAGG + Intergenic
930171409 2:48255387-48255409 TTGGAAGACAAGACCATTGGAGG + Intergenic
930783418 2:55246730-55246752 TTTTAAAGGATGACCACTGGTGG + Intronic
932856157 2:75235872-75235894 TTGGAAAGCTTGACCAATGGTGG + Intergenic
933210920 2:79567978-79568000 TTGAAGACCTTGACCACAGGAGG + Intronic
933360752 2:81280808-81280830 TTTATAAAAATGATCACTGGAGG - Intergenic
933544450 2:83692808-83692830 TTGATAAGCATGACTACTGGTGG - Intergenic
933696384 2:85221740-85221762 TTGCAAAACATGAACTTTGGGGG + Intronic
934972911 2:98777476-98777498 CTGAAAAGCAGGAGCACTGGGGG + Intergenic
935379148 2:102433110-102433132 TTGAATAACATTTCCATTGGTGG + Intronic
935521637 2:104113453-104113475 TGAAAACACATGAACACTGGTGG + Intergenic
936618316 2:114070795-114070817 TTGAAAAAATTCTCCACTGGGGG + Intergenic
937754586 2:125521144-125521166 TTGACAAAAATGAACATTGGAGG + Intergenic
937951719 2:127393190-127393212 TTCCAAAACATGACCTTTGGGGG + Intergenic
938584461 2:132675627-132675649 TAGAAGAACATGACCCCTGGAGG + Intronic
940824242 2:158392466-158392488 TTCAAAAAAATGTCCACTGGAGG + Intronic
941491320 2:166145331-166145353 TTTAAAAACATGATCCCTGCCGG - Intergenic
942406423 2:175661006-175661028 CTGAGAAACATCAGCACTGGAGG + Intergenic
942611856 2:177750487-177750509 TTACAGAACATGGCCACTGGTGG + Intronic
943135121 2:183900485-183900507 TTAAAACAAATTACCACTGGAGG + Intergenic
943171980 2:184413449-184413471 TTGGAAAACATGATCTCTAGTGG - Intergenic
945370083 2:209005702-209005724 TTGATAAAAATGAGGACTGGAGG + Intergenic
947028651 2:225767777-225767799 TTGTAAAACAAGTCCAGTGGTGG - Intergenic
947314379 2:228839562-228839584 TTAAAAAACAAGAACAATGGTGG - Intergenic
947351006 2:229245058-229245080 AAGAAAAACATGTCTACTGGTGG - Intronic
1171190335 20:23154495-23154517 TTTAAAAACAAGTCCATTGGTGG + Intergenic
1172233999 20:33357394-33357416 CTGAAAAAGAGGTCCACTGGTGG + Intergenic
1174336272 20:49863277-49863299 TTAAAAAACATGTACACTGTTGG + Intronic
1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG + Intronic
1174975762 20:55331955-55331977 GTCAAGAACATGACCACTTGAGG - Intergenic
1176845333 21:13872134-13872156 GAGAAAAACATGAACTCTGGGGG - Intergenic
1176970283 21:15257072-15257094 TTAAAAAAAAAGACCACTGAAGG + Intergenic
1178078134 21:29031852-29031874 TTGTAAAATGTTACCACTGGGGG - Intronic
1182628161 22:31663558-31663580 TTGAAAACCATGACAAAGGGAGG - Intergenic
952823648 3:37506666-37506688 TTGGGAAACATGACCTCTGAGGG + Intronic
953375071 3:42421618-42421640 TTTAAAAGGATGACCTCTGGAGG - Intergenic
955332632 3:58060218-58060240 TTGAAAAACATGCCCAAGGCTGG + Intronic
955441916 3:58965361-58965383 GTGAAAAACATGAGCATTTGGGG + Intronic
956936534 3:74107998-74108020 TTGCAAAACATTACCACTGGAGG + Intergenic
957118095 3:76053082-76053104 CTGGCCAACATGACCACTGGGGG - Intronic
959138310 3:102453077-102453099 ATGATAAAAATGACCACTGCTGG - Exonic
961462311 3:127058932-127058954 TTACAAACCATTACCACTGGGGG - Intergenic
962786957 3:138777517-138777539 TGGAAAAACATGACGTCTGAGGG - Intronic
967703922 3:192627748-192627770 TTGCAAAATATTACCATTGGGGG - Intronic
968703790 4:2069047-2069069 TTGAAAAACAGCAGCATTGGGGG - Exonic
969252648 4:5979694-5979716 TTGCAAAATATTCCCACTGGGGG - Intronic
969352444 4:6605549-6605571 TAGAAAAAAATGAGCACTGAGGG + Intronic
970174268 4:13322775-13322797 TTTAAAAACAGAACCACTGCTGG - Intergenic
970481041 4:16475010-16475032 TTGCAAAATATTACCACTGGGGG + Intergenic
971090981 4:23345615-23345637 TTGAACAACATAACCATTTGTGG - Intergenic
971548984 4:27925181-27925203 TTGAAACTCATGACCACTCCTGG - Intergenic
972218520 4:36924863-36924885 TTGTAAAACATGACCTATGTTGG + Intergenic
972554506 4:40168047-40168069 TAAAAAAACATAACCACTAGTGG + Intergenic
975988246 4:80226808-80226830 TTTAAAAACATGTCCACAGATGG + Intergenic
988346720 5:30046480-30046502 TTGAAAAACATGACTATTGAGGG - Intergenic
988795538 5:34650162-34650184 TTGAAAAACATGAACAAAGCCGG + Intergenic
989489492 5:42033365-42033387 TAAAAAAACATCACCACTGAGGG - Intergenic
990193588 5:53288884-53288906 GTGAACAACATCAACACTGGTGG - Intergenic
991178598 5:63721413-63721435 TTCAGAAACATCACCACTGATGG - Intergenic
991658299 5:68925125-68925147 TTTAAAAACATGTATACTGGGGG - Intergenic
992038217 5:72802676-72802698 CTGTAACACATGCCCACTGGGGG + Intergenic
992606998 5:78467935-78467957 TTGAAAAGCATGACCCCTAGTGG - Intronic
996349796 5:122525973-122525995 TTGACAAAAATGACCTCTTGAGG - Intergenic
996469025 5:123837882-123837904 TTGGAAAATATGACGACTTGTGG - Intergenic
996652292 5:125893878-125893900 ATGAATAACATGAACAATGGTGG + Intergenic
998251172 5:140554031-140554053 TGGGAAAAAATGATCACTGGAGG - Intronic
1000366701 5:160498012-160498034 TTGGGAAACATGAGCCCTGGAGG + Intergenic
1001251635 5:170151517-170151539 CTGGACAACATGACCTCTGGAGG - Intergenic
1001436448 5:171703133-171703155 ATGAAAAACATGCCCAGAGGTGG + Intergenic
1001633095 5:173191211-173191233 ATGTAAGACATCACCACTGGGGG + Intergenic
1001805654 5:174583644-174583666 TTGAAAAAATTGACCAAGGGAGG + Intergenic
1003661540 6:8066787-8066809 TTGCAAAATGTTACCACTGGGGG - Intronic
1004643129 6:17534815-17534837 TTGAAAAACACGACCCCTCAGGG - Intronic
1006268727 6:32947981-32948003 TGGCAGCACATGACCACTGGTGG - Intronic
1010008540 6:71023906-71023928 ATGAAAAACATGGCCTCTTGGGG - Intergenic
1010039593 6:71365779-71365801 TTGTAAAATGTGACCACTGGGGG + Intergenic
1012885347 6:104840096-104840118 TTGCAAAATGTTACCACTGGAGG + Intronic
1013799110 6:113919951-113919973 TTGAAGAGGATCACCACTGGAGG - Intergenic
1014924116 6:127250386-127250408 TTGAAAAACGATACCAGTGGAGG - Intergenic
1018321004 6:162608553-162608575 TTGCAAAACATGATCATTTGAGG - Intronic
1018725067 6:166605835-166605857 TGAAAACACATGACCAGTGGTGG + Intronic
1020506164 7:8991352-8991374 TTGCAAGACATTACCACCGGGGG + Intergenic
1021207664 7:17805132-17805154 TTGAAAAACATGACCACTGGTGG + Intronic
1021581041 7:22153698-22153720 TTGAAAAATGTGAGCACTGTGGG - Intronic
1023029718 7:36081456-36081478 TTCCAACACATGAACACTGGGGG - Intronic
1026655361 7:72251827-72251849 TTGCAAGACATTACCACTGGGGG + Intronic
1027773329 7:82434058-82434080 TTCAACACCATGAGCACTGGAGG + Intronic
1028451574 7:90991148-90991170 TTGAAAAGGAGTACCACTGGAGG + Intronic
1028579745 7:92395833-92395855 TTTAAAAACGTGACCAGGGGTGG - Intronic
1030400206 7:109040020-109040042 TTGAAAAACATGGCATCTGATGG - Intergenic
1030758056 7:113314042-113314064 TTGAAAAACATCACTAATGTTGG + Intergenic
1030985044 7:116231532-116231554 TGGAAAGACAGGACCACTGGAGG + Intronic
1031232336 7:119123869-119123891 TTGTAACACATGCCCACTGGGGG + Intergenic
1031268062 7:119607520-119607542 GTGAAGACCATTACCACTGGAGG + Intergenic
1031961838 7:127996906-127996928 TTGAAATTAAAGACCACTGGTGG - Intronic
1032484538 7:132275304-132275326 TTGTAAAATATAACCATTGGGGG - Intronic
1032495210 7:132356207-132356229 TAGAAAAACAGACCCACTGGAGG - Intronic
1032566153 7:132947974-132947996 TTGAAAGACACAACCATTGGGGG + Intronic
1032976852 7:137234674-137234696 TTGAAAAACATGTCCCCTTAAGG - Intronic
1033676582 7:143546066-143546088 TTGAAAAACATCTCCACTTTAGG + Intergenic
1033695251 7:143783372-143783394 TTGAAAAACATCTCCACTTTAGG - Intergenic
1034748243 7:153543540-153543562 CTAAACAACATGACAACTGGGGG + Intergenic
1035236755 7:157502251-157502273 ATGAAAAACATGATCATGGGAGG + Intergenic
1037037648 8:14187680-14187702 ATGAAAAAAATGACAACTGCAGG + Intronic
1038885199 8:31655665-31655687 TTCAAAAACATCACAACTGCTGG + Intronic
1038912734 8:31984904-31984926 TTGAAAAGCATTTGCACTGGGGG + Intronic
1040038453 8:42894277-42894299 TTGAAAACCGGGGCCACTGGAGG + Intronic
1040074584 8:43216249-43216271 TTGAAAACAATGACCACTTTTGG + Intergenic
1041034373 8:53773622-53773644 TGGAAAACCATGAACACTGAGGG + Intronic
1041333247 8:56751343-56751365 TTTCAACACATGATCACTGGGGG + Intergenic
1041447890 8:57973192-57973214 TTGAAAAAGATGGCCAATGTTGG - Intergenic
1042264494 8:66894231-66894253 ATGAAAAGCATGGCCACTTGGGG - Intronic
1042400848 8:68344522-68344544 TTGCAAAATATTACCAATGGAGG + Intronic
1043341285 8:79243054-79243076 ATCAAAAACATGATCTCTGGAGG - Intergenic
1044668298 8:94653325-94653347 GTTAAGAACATGAACACTGGGGG + Intronic
1045014979 8:97993362-97993384 TTGAAATAAATGACCACTGATGG - Intronic
1046265865 8:111829130-111829152 CTGAAAAACATGAGCTCAGGTGG + Intergenic
1047006479 8:120625209-120625231 TTCCAACACATGAACACTGGGGG + Intronic
1050282015 9:4060357-4060379 TTGAAAGGGATGACCACTGAAGG - Intronic
1050645104 9:7711259-7711281 GTAATAAACTTGACCACTGGGGG - Intergenic
1051262545 9:15278651-15278673 TTTAAAACCATCACCAGTGGAGG + Intronic
1051280331 9:15436583-15436605 TTGAAAAACATGAACAAAGTTGG - Intronic
1051428513 9:16959183-16959205 TTGAAGACCATGGGCACTGGAGG - Intergenic
1052447535 9:28583797-28583819 TTCAAAAACATGAACTTTGGGGG - Intronic
1053406222 9:37878474-37878496 TTGAAAAACATCTCCACTTTAGG - Intronic
1053437223 9:38084039-38084061 TTGCAAAACTGGTCCACTGGAGG - Intergenic
1055775174 9:79760160-79760182 CTGGAAAACATGGCCACTGGGGG + Intergenic
1056312084 9:85351076-85351098 TTAAAAAACATGACTTCTGCTGG - Intergenic
1057000796 9:91507122-91507144 TGGAAAAACATGAACATTGATGG + Intergenic
1057001122 9:91510565-91510587 TGGAAAAACATGAACATTGATGG + Intergenic
1057091436 9:92261652-92261674 TTGCAAAATGTGACCACTGGGGG + Intronic
1057339477 9:94186657-94186679 TTGAAAAAGAACAACACTGGAGG - Intergenic
1058130268 9:101243943-101243965 CTGGAAAACATGACCATTTGAGG + Intronic
1060935356 9:127511506-127511528 TTAAAAAAAAAAACCACTGGGGG + Intronic
1061512563 9:131069942-131069964 TTGCAAAGCCTGAGCACTGGGGG - Intronic
1186029253 X:5348921-5348943 TTGAAAAACATGAGGGTTGGGGG - Intergenic
1187281000 X:17858813-17858835 GGGCAAAACATCACCACTGGAGG + Intronic
1191048727 X:56168007-56168029 TTGATAAAAATCTCCACTGGTGG - Intergenic
1192086892 X:68108068-68108090 TTGAAAAACAAAACTCCTGGAGG - Intronic
1193410396 X:81155987-81156009 TTGAAAGTCATTACCACTGGGGG + Intronic
1196027714 X:111059138-111059160 TTGAAAAAAAAGGCCATTGGAGG + Intronic
1196125149 X:112089685-112089707 TTGAAAAAGAAGACCAATGTTGG - Intergenic
1197444523 X:126534047-126534069 ATGAAAAACATTACTAATGGAGG - Intergenic
1199180238 X:144845931-144845953 TTCAAAAACAAAACCAGTGGTGG - Intergenic
1199463051 X:148104830-148104852 TTGCAAAACATTACCATTGGGGG + Intergenic
1199680360 X:150220190-150220212 TTGCAAAACATTACCACTGGCGG + Intergenic
1200814291 Y:7515890-7515912 TTGCAAGACATTACCCCTGGGGG - Intergenic
1202021291 Y:20467463-20467485 TTGAAGGAGATGACCATTGGGGG + Intergenic