ID: 1021207979

View in Genome Browser
Species Human (GRCh38)
Location 7:17807930-17807952
Sequence CCTTCAGATGGGTTTCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 4, 2: 6, 3: 34, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021207979_1021207983 0 Left 1021207979 7:17807930-17807952 CCACACAGAAACCCATCTGAAGG 0: 1
1: 4
2: 6
3: 34
4: 253
Right 1021207983 7:17807953-17807975 TCAGCAACATCAAAGACCAAAGG 0: 11
1: 1111
2: 2988
3: 1539
4: 1100
1021207979_1021207985 23 Left 1021207979 7:17807930-17807952 CCACACAGAAACCCATCTGAAGG 0: 1
1: 4
2: 6
3: 34
4: 253
Right 1021207985 7:17807976-17807998 TAGATAAATTCACGAAGAAGAGG 0: 1
1: 15
2: 278
3: 1071
4: 6206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021207979 Original CRISPR CCTTCAGATGGGTTTCTGTG TGG (reversed) Intronic