ID: 1021209016

View in Genome Browser
Species Human (GRCh38)
Location 7:17821822-17821844
Sequence ATGGATGTGAATATGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 816
Summary {0: 1, 1: 0, 2: 3, 3: 85, 4: 727}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021209016_1021209021 -4 Left 1021209016 7:17821822-17821844 CCATCCTCCATATTCACATCCAT 0: 1
1: 0
2: 3
3: 85
4: 727
Right 1021209021 7:17821841-17821863 CCATAAGGTATTACATATAATGG 0: 1
1: 0
2: 0
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021209016 Original CRISPR ATGGATGTGAATATGGAGGA TGG (reversed) Intronic
900896808 1:5488382-5488404 ATGGATGTAAAGATGATGGATGG - Intergenic
900908896 1:5580201-5580223 TTGGATGTGAAGATGAAGGCTGG + Intergenic
900937931 1:5778770-5778792 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
901011002 1:6202012-6202034 ATGGGAGTGAGGATGGAGGATGG - Intronic
901186489 1:7376689-7376711 CAGGTTGTGAACATGGAGGATGG + Intronic
901224729 1:7606701-7606723 GGGGATGGGAACATGGAGGATGG + Intronic
901253168 1:7797196-7797218 ATGGATGTGAGCATGGATGTGGG + Intronic
901963370 1:12845376-12845398 AGGGAAGTGAAAATGGAGGCTGG + Intergenic
902247384 1:15129744-15129766 CTGGCTGTGGAGATGGAGGAAGG + Intergenic
902275787 1:15338355-15338377 CTGGCTTTGAAGATGGAGGAAGG - Intronic
902922101 1:19672204-19672226 ATGGATGGGAGTGGGGAGGAAGG - Intronic
903090795 1:20914412-20914434 CTGGCTTTGAAGATGGAGGAAGG + Intronic
903677870 1:25076046-25076068 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
903757450 1:25672510-25672532 CTGGCTTTGAAGATGGAGGAAGG - Intronic
904461287 1:30681645-30681667 AGGGATTCAAATATGGAGGAGGG + Intergenic
904464535 1:30700027-30700049 ATGGATGTATATGTGGATGAAGG - Intergenic
904838229 1:33353500-33353522 AAGGAAGAGAATATGGAGAAAGG - Intronic
905737584 1:40340517-40340539 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
908096783 1:60747630-60747652 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
908808304 1:67953534-67953556 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
909363785 1:74796349-74796371 TTGGCTTTGAAAATGGAGGAAGG + Intergenic
910144774 1:84067025-84067047 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
910530833 1:88233594-88233616 ACAGATGAGAAAATGGAGGATGG - Intergenic
910961650 1:92770025-92770047 CTGGGTTTGAAGATGGAGGATGG + Intronic
911936581 1:103983039-103983061 TTAGATATGAATGTGGAGGAAGG + Intergenic
912425653 1:109587546-109587568 ATATATGAGAATATGGAGGTAGG + Intronic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
915244210 1:154544701-154544723 GTGGATGTGAAAGTGGAGGTAGG - Intronic
915482975 1:156199792-156199814 AGGGATGTGAAGAAGGAGGGTGG - Intronic
915524690 1:156468400-156468422 GAGGATGAGAATATGGGGGATGG + Intronic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916561662 1:165938996-165939018 ATGCACCTGAAGATGGAGGAAGG - Intergenic
916704882 1:167339108-167339130 CTGGCTTTGAAGATGGAGGAAGG - Intronic
916822926 1:168417240-168417262 AAGGATTTGAGGATGGAGGAAGG + Intergenic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917447045 1:175115243-175115265 AGGGATGTGACTATGCTGGATGG + Intronic
917808987 1:178639152-178639174 AGGGATGGGAATAGGGATGAGGG - Intergenic
918370556 1:183857202-183857224 CTGGCTTTGAAGATGGAGGAAGG + Intronic
918418252 1:184335016-184335038 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
919482786 1:198109885-198109907 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
920177672 1:204113149-204113171 ATGGGTGTGAGGATGGAGGCAGG - Intronic
920748918 1:208655655-208655677 ATGGGTGTGAAGAAGGAGAATGG - Intergenic
921342034 1:214143854-214143876 AAGCAAGTGAATATGGTGGAAGG + Intergenic
921374358 1:214458851-214458873 ATGGATGTGTAAATGGAGCTGGG - Intronic
922144166 1:222922024-222922046 ATGGATGGGATTATGGAAGTTGG + Intronic
922511953 1:226176104-226176126 GTGGCTCTGAAGATGGAGGAAGG + Intronic
923286242 1:232498647-232498669 CTTGCTGTGAAGATGGAGGAAGG - Intronic
923367568 1:233277731-233277753 ATGGAGGGGAGTGTGGAGGAGGG + Intronic
923563937 1:235062681-235062703 AGGGGTGTGCATGTGGAGGAAGG - Intergenic
923760234 1:236835595-236835617 TTGGATGTCAACATGGATGATGG + Exonic
924530353 1:244888641-244888663 CTGGCTTTGAACATGGAGGAAGG + Intergenic
924632345 1:245752755-245752777 GTGGATGTGAAGCTGGAGGAAGG - Intronic
924863059 1:247946728-247946750 CTGGGGGTGATTATGGAGGAGGG - Intronic
1063539035 10:6913524-6913546 ATAGATATGAATATGGATGAAGG + Intergenic
1063865456 10:10360443-10360465 ATGCATGTGAAAAAAGAGGAAGG + Intergenic
1063877603 10:10496549-10496571 ATGGATGAAAAGATGGAGGGTGG + Intergenic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1064753631 10:18556048-18556070 ATGGAAGGGAAAATGGAGAATGG + Intronic
1064753912 10:18557922-18557944 ATGGAAGGGAAAATGGAGAATGG + Intronic
1064755683 10:18570269-18570291 ATGGAAGGGAAAATGGAGAATGG - Intronic
1065395437 10:25231726-25231748 ACAGAGGTGAATATGGAGGATGG + Intronic
1065642891 10:27803379-27803401 AGAGATGTGTATATGGGGGAGGG - Intergenic
1065794738 10:29295797-29295819 CTGGCTGTGAAGATGGAGTAAGG + Intronic
1065947997 10:30624934-30624956 CTGGCTGTGAAGATGGAGTAAGG + Intronic
1066529028 10:36316119-36316141 ATTGAGGAGAATAAGGAGGAGGG - Intergenic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1069218299 10:65850833-65850855 ATTGGTGTGAATGTGGTGGAAGG + Intergenic
1069310091 10:67024196-67024218 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070210774 10:74318271-74318293 ATGGAGGTGGAGATGGAGGAAGG - Intronic
1070261171 10:74857366-74857388 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070363388 10:75712563-75712585 CTGGATGTGAGAATGGATGAGGG + Intronic
1070448916 10:76537572-76537594 CTGGCTCTGAAAATGGAGGAAGG - Intronic
1070472424 10:76796004-76796026 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
1070853448 10:79585966-79585988 ATGGGTGTGAGTTTGGAGGAAGG - Intergenic
1070858393 10:79628422-79628444 ATGAGTGTGAGTTTGGAGGAAGG + Intergenic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1071529251 10:86376776-86376798 AGGGAGTTGAATAAGGAGGAAGG + Intergenic
1071979300 10:90987565-90987587 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072910511 10:99496847-99496869 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1073190774 10:101649365-101649387 ATGGATGTGATAATGGTGGGTGG - Intronic
1074134594 10:110615657-110615679 GTGGGGGTGAATATGGAAGATGG - Intergenic
1074153175 10:110776530-110776552 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1074202995 10:111256435-111256457 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1074494038 10:113963434-113963456 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1074702654 10:116106085-116106107 CTGGTTCTGAAAATGGAGGAAGG + Intronic
1075142219 10:119849134-119849156 CTGGCTATGAATATGGAAGAAGG + Intronic
1075272513 10:121064658-121064680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1075473733 10:122714943-122714965 ATAGATGTGAAAATGGAGACAGG - Intergenic
1075501422 10:122978710-122978732 ATGGGTGTGGATGTGGAGGATGG + Intronic
1075508850 10:123052343-123052365 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1075682796 10:124344322-124344344 CTGGCTGTGAAGCTGGAGGAAGG - Intergenic
1076071328 10:127492338-127492360 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1076292445 10:129357147-129357169 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077470287 11:2755138-2755160 ATGGCTCTGAAGATAGAGGAAGG - Intronic
1077537557 11:3131754-3131776 ATGGATGGGAAGATGGTGGATGG - Intronic
1077781654 11:5336557-5336579 GCAGATGTGATTATGGAGGAAGG - Intronic
1078532726 11:12149460-12149482 AGGGAGGTGAATCTGGAGGCAGG + Intronic
1078919278 11:15813265-15813287 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079252488 11:18796993-18797015 ATGGAAGTGAATAGGGAAAAAGG - Intergenic
1079414068 11:20216504-20216526 TTGGCTGTGAAGAGGGAGGAAGG - Intergenic
1079685548 11:23354862-23354884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1080247890 11:30199977-30199999 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080347879 11:31345441-31345463 ATGCATGTGAATATAGGTGATGG - Intronic
1080686428 11:34519218-34519240 AAGGATGTGAAGATGGAGCATGG + Intergenic
1080709737 11:34735149-34735171 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1081293975 11:41362814-41362836 CTGGCTGTGAAGATGAAGGAAGG - Intronic
1083045242 11:59728672-59728694 ATACATTGGAATATGGAGGAAGG - Intronic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084609790 11:70194792-70194814 ATGGATGTGTGAATGGATGAAGG + Intergenic
1084684617 11:70686310-70686332 ATGGATGGGTAGATGGATGATGG - Intronic
1084684637 11:70686405-70686427 ATGGATGGGTAGATGGATGATGG - Intronic
1084705150 11:70811798-70811820 ATGGATGGGTAGATGGATGATGG - Intronic
1084781845 11:71414982-71415004 ATGGATGGGTAGATGGATGATGG + Intergenic
1084875476 11:72129177-72129199 AGTCATGTGAACATGGAGGAAGG - Intronic
1085235098 11:75008483-75008505 GTGGATAGGAATAGGGAGGATGG + Exonic
1085344567 11:75759830-75759852 ATGAATGTGAATTTGCAGGATGG - Intronic
1085506957 11:77066445-77066467 ATGGATGTGAAGGTGGAGCCCGG + Intergenic
1085550401 11:77364950-77364972 ATGAATTTGAAAATGGAGGTGGG + Intronic
1086055996 11:82647105-82647127 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
1086079497 11:82888782-82888804 AGGTGTGTGTATATGGAGGAGGG - Intronic
1086141006 11:83500253-83500275 ATGGATGTAAGTATCTAGGACGG + Intronic
1086594439 11:88554223-88554245 CTGGCTTTGAATGTGGAGGAAGG - Intronic
1087101320 11:94367997-94368019 ATGGCTTTGAAGCTGGAGGAAGG + Intergenic
1087726678 11:101725989-101726011 AAGGAAGAGAATAAGGAGGAAGG + Intronic
1087727932 11:101743601-101743623 TTGGATGTAAATTTGTAGGAAGG - Intronic
1088919860 11:114252863-114252885 GAGGATGTGAATTGGGAGGACGG + Intergenic
1088968693 11:114751922-114751944 ATGGCTTTGAAGATGGAGAATGG + Intergenic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1090537461 11:127659418-127659440 ATTGATGTGAATGAGGAGCATGG + Intergenic
1091425475 12:384434-384456 ATGGATGGGGGTATGGAGGATGG - Intronic
1091482936 12:853733-853755 ATGTATGTGCTTATGGAAGAAGG + Intronic
1092216067 12:6683710-6683732 ATGGATGTGAAAACGTAGGAAGG + Intronic
1092584297 12:9880574-9880596 AGGAATGTGATTATGGAGGCTGG + Intergenic
1092654559 12:10671488-10671510 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1093338840 12:17946182-17946204 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1094732087 12:33188611-33188633 CTGGATTTTAAGATGGAGGAGGG + Intergenic
1095113698 12:38329312-38329334 ATGTATGTTAATATGGCTGAAGG - Exonic
1095236487 12:39802322-39802344 ACGTATGTGAAGATGGTGGAAGG + Intronic
1097015364 12:55982432-55982454 ATTGCTGTGAACAGGGAGGAAGG + Intronic
1097290573 12:57911042-57911064 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097378995 12:58873012-58873034 GTGGATGTAAATATGAGGGAAGG - Intronic
1097429851 12:59491436-59491458 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1097946933 12:65379222-65379244 ATGGATGGGTAGATGGTGGATGG - Intronic
1098644547 12:72881954-72881976 ACGAAGGTGAAAATGGAGGAGGG + Intergenic
1099023787 12:77440259-77440281 TTGGCTTTGAAAATGGAGGAGGG - Intergenic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1100714657 12:97293326-97293348 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1100874008 12:98943567-98943589 ATGGTCTTGAAGATGGAGGAAGG - Intronic
1101407708 12:104443271-104443293 GTGGCTTTGAAGATGGAGGATGG + Intergenic
1101660470 12:106760513-106760535 CTTGGTGTGAATGTGGAGGAAGG - Intronic
1102436393 12:112927436-112927458 ATGGCTGAGAATAGGGAGGGAGG - Intronic
1102445757 12:113001601-113001623 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1102991632 12:117320378-117320400 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1103192789 12:119016641-119016663 ATGGAGGAGAATATGGAACAGGG - Intronic
1103245656 12:119454883-119454905 ATGGAAGCAAATACGGAGGATGG - Intronic
1103284045 12:119785411-119785433 ATGGCTTTGAACACGGAGGAAGG + Intronic
1103799423 12:123527808-123527830 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1104010307 12:124925556-124925578 ATGGAAGAGGATAGGGAGGACGG - Intergenic
1104166837 12:126239889-126239911 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1104453007 12:128886601-128886623 ATGGCTCTGGACATGGAGGAAGG - Intronic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1105293541 13:19070148-19070170 ATGGGTGTGACTATGGATGTGGG - Intergenic
1105310112 13:19198977-19198999 ATGGCGGTGATGATGGAGGAGGG + Intergenic
1105500647 13:20968543-20968565 ATGGAGGGGAATGTGGAGGTGGG + Intergenic
1105745317 13:23372817-23372839 ATGGATGTGGATGTGGGGGATGG - Intronic
1106079973 13:26492157-26492179 ATAGATGTATATATGAAGGAGGG + Intergenic
1106454725 13:29917133-29917155 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1107368588 13:39714626-39714648 ATTGATGTGGATATGGTGAAAGG + Intronic
1107638473 13:42416925-42416947 TTGGCTTTGAAAATGGAGGAAGG + Intergenic
1107702897 13:43066369-43066391 TTGGCTTTGAAAATGGAGGAAGG - Intronic
1107732108 13:43358724-43358746 ATAGATGAGAAAATGGAGGCAGG + Intronic
1107884932 13:44867350-44867372 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1107965660 13:45596261-45596283 AGGGATGAGTATCTGGAGGAGGG - Intronic
1108033071 13:46257124-46257146 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1108220138 13:48224930-48224952 AGGGCTGGGAATATGGGGGATGG + Intergenic
1108698906 13:52927015-52927037 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1108857046 13:54806370-54806392 TTGGCTTTGAAAATGGAGGAAGG - Intergenic
1109351867 13:61192975-61192997 TTGGGTGTGAATAAGGAGGGAGG + Intergenic
1110165529 13:72438243-72438265 ATATATGTAAATATGCAGGATGG - Intergenic
1110408386 13:75176278-75176300 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1110409221 13:75185480-75185502 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1110575309 13:77048489-77048511 AGGGATGTGAGTAGGGAAGATGG - Intronic
1110837525 13:80101599-80101621 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1111547663 13:89763971-89763993 ATGGGTGTGTATATGTATGATGG - Intergenic
1111629927 13:90837545-90837567 ATGGGTTTGAAAATGGAGGAGGG - Intergenic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112585059 13:100711758-100711780 GTGGATGTTAGAATGGAGGAAGG - Intergenic
1113033974 13:106028193-106028215 ATGGAAGTGAGGATGGACGAAGG - Intergenic
1113144038 13:107187021-107187043 CTGGATTTTAAGATGGAGGAAGG - Intronic
1113976291 13:114230212-114230234 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1114967761 14:27984526-27984548 AGGGTTGTGAATGTGGAGGTCGG + Intergenic
1115162565 14:30412330-30412352 CTGGCTGTGAAGATGGAAGAAGG - Intergenic
1115668238 14:35578045-35578067 AAGAAGGTGGATATGGAGGAGGG - Intronic
1115697650 14:35917629-35917651 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1116001898 14:39252359-39252381 CTGGCTTTGAAAATGGAGGATGG + Intronic
1116370533 14:44125071-44125093 GTGGCTTTGAAAATGGAGGAAGG - Intergenic
1116968314 14:51038242-51038264 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1117363317 14:54999336-54999358 ATGCATGTGAAGATGGGGGAGGG + Intronic
1118067996 14:62213025-62213047 ATGTATGTGAATGTGGAGGTGGG - Intergenic
1118068010 14:62213147-62213169 ATGTATGTGAATGTGGAGGTGGG - Intergenic
1118315013 14:64720865-64720887 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1120836540 14:89042898-89042920 CTGGCTTTGAAGATGGAGGACGG + Intergenic
1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG + Intronic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121717009 14:96083582-96083604 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1121958671 14:98238458-98238480 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1122020785 14:98836357-98836379 CTGGCTGCGAAGATGGAGGAAGG - Intergenic
1122388192 14:101362988-101363010 ATGGGTGTGGACATGGCGGATGG - Intergenic
1122420927 14:101576886-101576908 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1122910326 14:104824710-104824732 ATGGATGGTAAGATGGTGGATGG + Intergenic
1124051434 15:26200474-26200496 ATGCATATGGAAATGGAGGAGGG - Intergenic
1125215119 15:37263289-37263311 ATGGATGTGAAACTGGTGGTGGG - Intergenic
1126145318 15:45468279-45468301 AGGGAGGTGAGTTTGGAGGATGG + Intergenic
1126158355 15:45586093-45586115 TTGGCTTTGAATATAGAGGAAGG - Intergenic
1126424722 15:48515078-48515100 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1127210684 15:56771643-56771665 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1127814191 15:62592091-62592113 GGGGATGTGTATAAGGAGGAGGG + Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1129118944 15:73383261-73383283 AGGGCTTTGAAGATGGAGGAAGG + Intergenic
1131007125 15:88987323-88987345 AGGGAATTGAATGTGGAGGAGGG - Intergenic
1131532293 15:93204356-93204378 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1131771488 15:95742689-95742711 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1131940387 15:97558417-97558439 CTAGATTTGAAGATGGAGGAAGG - Intergenic
1132110953 15:99101976-99101998 ATGTCAGTGAATATGGAGTAGGG + Intronic
1132319245 15:100913439-100913461 CTGGCTTTGAAGATGGAGGATGG - Intronic
1133042669 16:3068801-3068823 ATGGAGGTGAATGCAGAGGAGGG + Intronic
1133191616 16:4137901-4137923 CTGGATGTGACTTGGGAGGAGGG - Intergenic
1133229584 16:4360205-4360227 ATGTATGTGACTGTGGAGAAGGG + Intronic
1133467509 16:6042025-6042047 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1133493050 16:6290261-6290283 ACGAAGGTGAATATGGAGAAGGG + Intronic
1133534846 16:6691905-6691927 CTGGTTTTGAATATGGAGGAAGG + Intronic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1135073577 16:19373699-19373721 CTGGCTCAGAATATGGAGGAGGG + Intergenic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1135527037 16:23221463-23221485 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1135845384 16:25913834-25913856 ATGTATGTGGATGTGGAGGGAGG + Intronic
1135908772 16:26540405-26540427 ATGGATCTGCATATGAAGGGTGG + Intergenic
1136297935 16:29314242-29314264 TTGGATGTGAAGCTGGAGGCCGG + Intergenic
1137339856 16:47590962-47590984 ATGGAGGTAAGTATGGATGAAGG - Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579736 16:49626700-49626722 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579754 16:49626775-49626797 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579771 16:49626850-49626872 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579781 16:49626892-49626914 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579793 16:49626951-49626973 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579802 16:49626986-49627008 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579819 16:49627061-49627083 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579829 16:49627103-49627125 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579842 16:49627162-49627184 ATTGATGGGTAGATGGAGGATGG - Intronic
1137579857 16:49627229-49627251 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579868 16:49627276-49627298 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579879 16:49627323-49627345 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137579901 16:49627418-49627440 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579912 16:49627465-49627487 ATGAATGGGTAGATGGAGGATGG - Intronic
1137579924 16:49627524-49627546 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579935 16:49627568-49627590 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579959 16:49627688-49627710 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580000 16:49627866-49627888 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580017 16:49627941-49627963 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580038 16:49628032-49628054 ATGGATGGGTAGATGGAAGATGG - Intronic
1137580050 16:49628091-49628113 ATGGATGGGTAGATGGAGGGTGG - Intronic
1137580061 16:49628135-49628157 ATGGATGGGTAGATGGACGATGG - Intronic
1137580085 16:49628245-49628267 ATGGATGGGTAGATGGAGTATGG - Intronic
1137930992 16:52587626-52587648 AGAGATGTGAATGAGGAGGAGGG - Intergenic
1138495745 16:57408190-57408212 GTGGATGTGTGTATGGATGATGG - Intronic
1138756902 16:59498118-59498140 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1139111135 16:63892304-63892326 CTAGTTGAGAATATGGAGGAAGG + Intergenic
1139436808 16:66941233-66941255 ATGGATGTGGGTGTAGAGGAAGG + Intronic
1139504480 16:67392199-67392221 GTGGGTGTGAAGATGGAGGATGG - Intronic
1140051632 16:71486491-71486513 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1140357050 16:74315383-74315405 ATGGAGTAGAATAGGGAGGAGGG - Intergenic
1140661035 16:77191474-77191496 AGGGATGTGCAGATGGAGGTCGG + Exonic
1140684208 16:77417306-77417328 ATGGATGGGAGAATGGAAGAAGG + Intronic
1141149206 16:81552539-81552561 GTGGCTCTGAAGATGGAGGAAGG - Intronic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1141487412 16:84349912-84349934 AGAGATTTGAAGATGGAGGAAGG + Intergenic
1141763433 16:86043840-86043862 AGGGCTGTGAAGATGGGGGAAGG + Intergenic
1141855035 16:86674895-86674917 ATGGATGTTAATGAGCAGGAAGG - Intergenic
1142059581 16:88020747-88020769 TTGGATGTGAAGCTGGAGGCCGG + Intronic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1142208232 16:88794008-88794030 ATGGATGGGAATATAGAGGGCGG - Intergenic
1142947617 17:3446056-3446078 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1144149972 17:12433901-12433923 ATGCGTATGCATATGGAGGAGGG - Intergenic
1144365819 17:14543218-14543240 TTGGATGTGAGTATGGGGCAGGG + Intergenic
1145089157 17:19972173-19972195 AAGGATGAGAATATGAAGCATGG - Intronic
1145262463 17:21362792-21362814 ATGGATGTGCAGATGGATGGAGG + Intergenic
1146491015 17:33282387-33282409 ATGGCTTTGAAGATGGAAGAGGG - Intronic
1146753215 17:35401058-35401080 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1149018224 17:51933391-51933413 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149302210 17:55315916-55315938 AAGGTTGGCAATATGGAGGAAGG - Intronic
1149383180 17:56114897-56114919 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1150905552 17:69333013-69333035 CTGGCAGTGAAGATGGAGGAAGG + Intergenic
1150943955 17:69724132-69724154 AGGGAAGGGAATAGGGAGGAAGG + Intergenic
1151025488 17:70671749-70671771 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152097968 17:78283263-78283285 AAAGATGTGAATTTGGAAGAGGG - Intergenic
1152473645 17:80503833-80503855 GTGGATGTGTGGATGGAGGATGG + Intergenic
1153276910 18:3376553-3376575 CTAGCTGTGAAGATGGAGGAAGG - Intergenic
1153327894 18:3840409-3840431 TTGGTTGTGAAGATGGAGAAAGG - Intronic
1153557447 18:6330435-6330457 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1153617854 18:6951099-6951121 ATGGATGTGTAAATGGATGAAGG - Intronic
1153842420 18:9018735-9018757 TTGGTTTTGAAGATGGAGGAAGG + Intergenic
1153993652 18:10421648-10421670 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1154031235 18:10756019-10756041 AGGGATGGGGATAAGGAGGAGGG + Intronic
1154301852 18:13201141-13201163 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1154335947 18:13464868-13464890 ATGCACATGAATATGGAGCACGG - Intronic
1155758047 18:29526609-29526631 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1155835947 18:30584197-30584219 ATATATCTGAATCTGGAGGAAGG - Intergenic
1156314197 18:35952027-35952049 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
1156592083 18:38501821-38501843 AAGGAAGTGAAAAAGGAGGAAGG + Intergenic
1157618747 18:49003264-49003286 GTGGAAGGGAAAATGGAGGAGGG - Intergenic
1158731188 18:60024346-60024368 ATGAATGTAAAGATGCAGGATGG + Intergenic
1158992672 18:62886004-62886026 ATGGCTGTGAAGCTGGAGAAAGG + Intronic
1159313590 18:66741171-66741193 ATGGCAGTGAAGATGGAGAAAGG - Intergenic
1159421393 18:68225274-68225296 CTGGCTGTGAATATGGAGGTTGG + Intergenic
1159916745 18:74194747-74194769 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1160015997 18:75141216-75141238 ATGGCTTTGAATATGGAGGAAGG + Intergenic
1160087075 18:75786480-75786502 GGGGATGTGACCATGGAGGAAGG - Intergenic
1160113465 18:76055587-76055609 ATGGATGTGAGTATGGGAAATGG - Intergenic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160681819 19:415181-415203 ATGGATGTGTAGATGGGGGATGG + Intergenic
1160681837 19:415280-415302 ATGGATGTGTAGATAGGGGATGG + Intergenic
1160681860 19:415434-415456 ATGGATGTGTAGATGGGGGATGG + Intergenic
1160872043 19:1282118-1282140 AAGGATGTGAATGGAGAGGAAGG + Intergenic
1161066751 19:2242407-2242429 GTGGCTGTGAATGGGGAGGAAGG - Intronic
1161326908 19:3668437-3668459 GTGGCTGTGAAGAGGGAGGAAGG + Intronic
1161468378 19:4444525-4444547 ATGGCTGTGAAGGTGGAGGAAGG - Intronic
1161655292 19:5510658-5510680 CTGGCTGTGAAGGTGGAGGAGGG - Intergenic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1162062935 19:8107688-8107710 ATGAATGGGTAGATGGAGGATGG + Intronic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1162776992 19:12985894-12985916 ATGGAGGGGAAGATGGAGGGAGG - Intergenic
1162786913 19:13040727-13040749 AGGAATGTGAATAGGGAGGGAGG + Intronic
1163382599 19:16978805-16978827 ATGGATGGGTAGATGGTGGATGG - Intronic
1163462325 19:17446613-17446635 AGGGTTGTGAGTAAGGAGGAAGG - Intronic
1163571257 19:18083697-18083719 ATGGATGGGTAGATGGTGGACGG - Intronic
1165355049 19:35299461-35299483 ATGGAGGTGGACAAGGAGGAGGG + Intronic
1165424009 19:35735833-35735855 GTGGATGTGAAGAAGGGGGATGG - Intronic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1166763072 19:45236551-45236573 ATGGAATTGAAAATGGAGGTTGG + Intronic
1167144159 19:47672101-47672123 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144174 19:47672163-47672185 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144182 19:47672194-47672216 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144213 19:47672316-47672338 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144221 19:47672347-47672369 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144229 19:47672378-47672400 ATGGATGGAAGGATGGAGGATGG + Intronic
1167157814 19:47750101-47750123 ATGGAGGTGAATAGGGTGGGTGG + Intronic
1167601220 19:50455969-50455991 GTGGATGTTAAGATGGATGAAGG - Intronic
1167758366 19:51427230-51427252 GTGGCTGTGAGAATGGAGGAAGG + Intergenic
925232450 2:2245858-2245880 CTGGCTGTGAACATGGAGGCTGG + Intronic
925260202 2:2522066-2522088 ATGGATGGGCAGATGGGGGATGG - Intergenic
925529967 2:4848672-4848694 ATGGCAGTTGATATGGAGGATGG + Intergenic
925735429 2:6959323-6959345 ATGGAAGTGAAAGTGGAGCATGG + Intronic
925925624 2:8668101-8668123 ATGGATGGAAAAATGGATGAAGG + Intergenic
926544776 2:14226072-14226094 TTGGCTTTGAATATGGAGGAAGG - Intergenic
927716741 2:25358144-25358166 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
927761200 2:25756325-25756347 ATGGATGTGAATGGAGAGAAAGG - Intronic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
928309343 2:30196747-30196769 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
928600251 2:32897428-32897450 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
928688802 2:33777494-33777516 ATGGATGTGAAAATGGGAGCAGG - Intergenic
929827900 2:45324013-45324035 ATGACTTTGAAGATGGAGGAGGG - Intergenic
929862883 2:45694350-45694372 TTGGATCTGGATATGGATGATGG + Intronic
931500263 2:62856985-62857007 CTGGCTTTGAAGATGGAGGAAGG + Intronic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
932849273 2:75168478-75168500 CTGGCTTTGAAGATGGAGGAAGG + Intronic
933130990 2:78673810-78673832 AGGGATGTGAGGATGGAAGAGGG - Intergenic
933217983 2:79652467-79652489 CTGGATTTGAATATAGAGAAAGG - Intronic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
933585679 2:84177369-84177391 ATGAATGAGAATTTGGGGGAGGG + Intergenic
934843984 2:97649969-97649991 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
935109321 2:100077375-100077397 TTGGCTTTGAAGATGGAGGATGG + Intronic
935141539 2:100357554-100357576 CTGGCTTTGAAAATGGAGGAGGG - Intergenic
935296795 2:101656733-101656755 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
935391582 2:102558758-102558780 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG + Intergenic
936506575 2:113112492-113112514 AGGGATGTGAGTGTGGAGGCCGG + Intronic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937600088 2:123721177-123721199 GTGGCTTTGAAGATGGAGGAAGG - Intergenic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
939011153 2:136847298-136847320 ATGGAAGTGAATATGCATTAAGG + Intronic
939410381 2:141816729-141816751 ATACATGTGAGTATTGAGGATGG - Intronic
939450457 2:142367069-142367091 ATGGATGAGAAGCTGGAAGAGGG + Intergenic
939478334 2:142715493-142715515 AAGGCTTTGAAGATGGAGGAAGG - Intergenic
939543983 2:143529698-143529720 ATGAATGTGAATTTGGCAGATGG - Intronic
940224292 2:151385423-151385445 CTAGCTTTGAATATGGAGGAAGG + Intergenic
940385439 2:153065766-153065788 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
940556920 2:155240543-155240565 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
942545914 2:177063497-177063519 ATGGATGGGGAAATGGAGGAGGG - Intergenic
942889231 2:180966757-180966779 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943227430 2:185196258-185196280 ATACATGTGACTATGGAGTAGGG + Intergenic
943441517 2:187932925-187932947 AAGAATCTGGATATGGAGGATGG + Intergenic
944424326 2:199563553-199563575 ATGGAATGGAATATGGTGGATGG + Intergenic
945061798 2:205915818-205915840 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
945131325 2:206575879-206575901 ATGGAAGTGAGTAAGGAGTAGGG + Intronic
945547879 2:211180488-211180510 GTGGAGGTGAAGATGGATGAGGG + Intergenic
945938993 2:215929739-215929761 ATGCATTTGAATTTGGGGGATGG - Intergenic
947099169 2:226600812-226600834 ATGAATGTGAATATGAAATATGG + Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
949037422 2:241822232-241822254 CTGGGTTTGAAGATGGAGGAGGG + Intergenic
1168901314 20:1367503-1367525 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1169913793 20:10668233-10668255 ATGGTGGTGGAAATGGAGGAGGG - Intronic
1170045880 20:12084948-12084970 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1170402408 20:16002567-16002589 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1170517619 20:17148384-17148406 CTGGCTTTGAATATGGAGAAAGG - Intergenic
1171230988 20:23484910-23484932 CTGGCTTTGAATATAGAGGAAGG + Intergenic
1171538830 20:25926789-25926811 CTGGATTTGAAAATAGAGGAAGG + Intergenic
1171878139 20:30597535-30597557 ATGGCTGTGACTATGGATGTGGG - Intergenic
1172181340 20:33005556-33005578 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1173162923 20:40665652-40665674 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1173426885 20:42951097-42951119 ATGGATGAGAGAATGAAGGATGG + Intronic
1173488017 20:43455917-43455939 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1173554055 20:43953052-43953074 ACGGCTATGAAGATGGAGGAAGG + Intronic
1173796033 20:45860599-45860621 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1173863382 20:46298570-46298592 ATGGATGTTTAAATGGAGGTGGG + Intronic
1173871491 20:46344859-46344881 ATGGATGGGTAGATGGATGATGG - Intergenic
1174151067 20:48486690-48486712 ATGTGCTTGAATATGGAGGAAGG + Intergenic
1174505662 20:51015906-51015928 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1174539779 20:51279845-51279867 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175287366 20:57845851-57845873 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175375622 20:58521668-58521690 ATGGGTGTGGAGATGGAAGAGGG + Intergenic
1175711160 20:61222150-61222172 CTGGCTGTGAAGATGCAGGAAGG + Intergenic
1175817413 20:61890569-61890591 ATGGATGTGCAGATGATGGATGG + Intronic
1175855437 20:62118489-62118511 ATGGATGGGAAGAGGGAAGAGGG + Intergenic
1176982218 21:15396426-15396448 ATGGATGGAAATATGGGGAAGGG + Intergenic
1177318415 21:19491077-19491099 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1177496113 21:21894567-21894589 CTGTAGGTGGATATGGAGGATGG + Intergenic
1178183496 21:30191944-30191966 ATGAATGCGAAGATGGAAGAAGG - Intergenic
1178873794 21:36397006-36397028 AGCGAAGTGAATATGGAGCAGGG - Intronic
1179964844 21:44796869-44796891 CTGGCTGTGAAGATGGAAGAAGG - Intronic
1180849679 22:19009774-19009796 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1181024256 22:20118765-20118787 ATGTCTGTGAATCTGGGGGAGGG + Intronic
1181418249 22:22775779-22775801 CTGGATGTCAATGAGGAGGAAGG - Intronic
1181536730 22:23550160-23550182 ATGGATGGGTAGATGGATGATGG - Intergenic
1181537245 22:23552835-23552857 ATGGATGGGAAGATGGCTGAAGG - Intergenic
1181664912 22:24387930-24387952 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1182013648 22:27021204-27021226 ATGGATGTGGGTGTGGGGGATGG - Intergenic
1182273076 22:29167947-29167969 ATGGATGTGTACCTGGTGGATGG + Exonic
1182517314 22:30866279-30866301 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1183136717 22:35896072-35896094 TTGGATTTGAACATGGAGAAAGG - Intronic
1184293314 22:43509389-43509411 ATGGATGGGTAGATGGGGGATGG - Intergenic
1184388027 22:44187310-44187332 TTGGACGTGAAGATGGAGGTGGG - Intronic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1185364945 22:50433203-50433225 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185364965 22:50433265-50433287 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185364988 22:50433327-50433349 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365008 22:50433389-50433411 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365030 22:50433451-50433473 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365050 22:50433513-50433535 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365070 22:50433575-50433597 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365091 22:50433637-50433659 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365112 22:50433699-50433721 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365134 22:50433761-50433783 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365157 22:50433823-50433845 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365178 22:50433885-50433907 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365198 22:50433947-50433969 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365219 22:50434009-50434031 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365242 22:50434071-50434093 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365263 22:50434133-50434155 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365282 22:50434195-50434217 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365304 22:50434257-50434279 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365325 22:50434319-50434341 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365348 22:50434381-50434403 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365369 22:50434443-50434465 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365392 22:50434504-50434526 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365415 22:50434566-50434588 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365456 22:50434678-50434700 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365477 22:50434740-50434762 CTGGAGGTGAACCTGGAGGAGGG + Intronic
1185365498 22:50434802-50434824 CTGGAGGTGAACCTGGAGGAGGG + Intronic
949137957 3:593778-593800 TTAGCTGTGAATATGGAGGTGGG + Intergenic
949777224 3:7646722-7646744 ATGTATGAGAAGTTGGAGGATGG + Intronic
950146825 3:10656118-10656140 ATGGCTGGGAGTTTGGAGGAGGG + Intronic
950181533 3:10917044-10917066 CTGGATGTGACAATTGAGGAGGG + Intronic
950534220 3:13570025-13570047 ATGCAGGTGAGGATGGAGGATGG + Intronic
950543187 3:13624499-13624521 ATGGCTGGGAATGGGGAGGAGGG - Intronic
950921584 3:16700277-16700299 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
951051378 3:18097707-18097729 CTGGCTTTGAAGATGGAGGAAGG - Intronic
951110130 3:18793392-18793414 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
951305131 3:21050901-21050923 TTGGATGTGGATAGGGAGAAGGG - Intergenic
951632606 3:24737901-24737923 ATTGATGTGAAGCTGTAGGATGG + Intergenic
952190466 3:31017774-31017796 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
952721711 3:36540585-36540607 ATGGATGTGAAGATGGAGAAAGG + Intronic
953006700 3:38985542-38985564 ATGGCAGTGAAGATGGAGAAAGG + Intergenic
953379445 3:42456465-42456487 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
953534699 3:43768874-43768896 ATGAATTTGGATATGGAGAATGG + Intergenic
954140947 3:48605092-48605114 ATGGCTGTCAATAAGGAGGGGGG - Intronic
954623731 3:52010750-52010772 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
954732000 3:52672191-52672213 CTGGCTTTGAAGATGGAGGAAGG - Intronic
954854981 3:53636087-53636109 GTGGATGTGTATATGGTGGAGGG + Intronic
955023342 3:55142830-55142852 ATGTTTGTGTATATGGAGAATGG + Intergenic
955413172 3:58668994-58669016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
956317472 3:67954377-67954399 ATAAATATGAAAATGGAGGAAGG + Intergenic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957442733 3:80271458-80271480 ATGTATGTGCATATAGAGGCAGG + Intergenic
958513869 3:95086881-95086903 ATGGAGGTGAAGTGGGAGGAAGG - Intergenic
959266044 3:104140101-104140123 CTGGCTTTGAATATGGAGTAAGG + Intergenic
959322031 3:104888780-104888802 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
959472335 3:106767310-106767332 CTGGCTTTGAATTTGGAGGAAGG + Intergenic
959653705 3:108777306-108777328 ATGGAAGGGAGAATGGAGGATGG - Intergenic
960368115 3:116799127-116799149 ATGGATGGAAATTTGAAGGAAGG - Intronic
960619582 3:119625559-119625581 AGGGATGTCAGTAGGGAGGAGGG + Intronic
963115849 3:141728329-141728351 ATGGGAAAGAATATGGAGGAGGG + Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
963617467 3:147559824-147559846 CTGGATTTGAAGGTGGAGGAAGG - Intergenic
964281584 3:155072241-155072263 ATTGATGGGAATGAGGAGGATGG - Intronic
964509171 3:157431392-157431414 CTGGCTGTGAAGATGGAGAAAGG - Intronic
964561083 3:157997323-157997345 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
964897068 3:161611612-161611634 CTGGCTTTCAATATGGAGGAAGG - Intergenic
965108878 3:164395228-164395250 ATAGGTGTGAACATGTAGGAAGG + Intergenic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
966323435 3:178727625-178727647 CTGGCTTTGAAGATGGAGGAAGG + Intronic
967062115 3:185881719-185881741 ATTGATGTGATTATGGATCATGG + Intergenic
967346930 3:188467728-188467750 CTGGCTTTGAAGATGGAGGAAGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967497520 3:190158404-190158426 ATTGATGTGAATCTGGAGAAAGG + Intergenic
968162133 3:196435256-196435278 AAGAATATGAATATGAAGGATGG + Intergenic
968598395 4:1497092-1497114 ATGGATGTGTAGATGATGGATGG + Intergenic
968598421 4:1497265-1497287 ATGGATGTGTAGATGATGGATGG + Intergenic
968598432 4:1497343-1497365 ATGGATGTGTAAATGATGGATGG + Intergenic
968598451 4:1497471-1497493 ATGGATGTGTAGATGATGGATGG + Intergenic
968598469 4:1497552-1497574 ATGGATGAAGATATGGATGATGG + Intergenic
968781338 4:2584162-2584184 CTGGATATGAATATGGAGTGGGG - Intronic
968935820 4:3609895-3609917 ATGGATGAGTGGATGGAGGATGG - Intergenic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969342722 4:6552435-6552457 ATGGTTTTGAAGATGGAGGGAGG - Intronic
969571584 4:8012087-8012109 ATGGATGGGCAGATGGATGATGG - Intronic
970016352 4:11516803-11516825 CTGATTTTGAATATGGAGGAAGG - Intergenic
970821882 4:20226272-20226294 CTGGCTTTGAAGATGGAGGATGG + Intergenic
970938946 4:21608473-21608495 ATGCCTTTGAAAATGGAGGAAGG - Intronic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
971377222 4:26064713-26064735 ATAGATGATAATATGGTGGAGGG - Intergenic
971425973 4:26515878-26515900 CTGGATGTGAAGCTTGAGGAGGG + Intergenic
971454925 4:26835227-26835249 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
971961703 4:33496477-33496499 GAGGATGGGAATATGCAGGATGG - Intergenic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
973291706 4:48477522-48477544 ATGAATGTCAAAATGGAGGAGGG - Intergenic
974267934 4:59609773-59609795 AGTGATGTGAAAATGGAGTAGGG + Intergenic
974467237 4:62272924-62272946 ATGGATGAGAAGTGGGAGGAAGG - Intergenic
974598209 4:64040405-64040427 ATGGATGTTAATAATGAGAATGG - Intergenic
974757228 4:66225572-66225594 CTGGCTTTGAATATGAAGGAAGG - Intergenic
974799198 4:66793749-66793771 GTGGATGTGAGTATTCAGGAAGG - Intergenic
975062533 4:70020172-70020194 CTGGCTTTGAACATGGAGGAAGG - Intergenic
975086990 4:70353558-70353580 ATGGATGTGAATTTGAAGACTGG - Intergenic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
976069509 4:81224978-81225000 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
976223782 4:82779309-82779331 CTGGCTTTGAAGATGGAGGAAGG + Intronic
976287992 4:83388512-83388534 ATGTATGCGACTATGGAGGGCGG - Intergenic
976392583 4:84520675-84520697 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
976573633 4:86642216-86642238 AAGGATGTGAAAATAAAGGAAGG - Intronic
977334807 4:95684395-95684417 CTGGGTGTGAAGATGGGGGAAGG + Intergenic
977712163 4:100138795-100138817 TAGGATGTGATTATGAAGGAGGG - Intergenic
977732332 4:100368677-100368699 ATAGATGTGAATTTAGGGGAGGG - Intergenic
977870797 4:102088541-102088563 ATAGATGGGATTCTGGAGGATGG - Intergenic
978578155 4:110206541-110206563 GTGGACATGAATTTGGAGGAAGG + Intergenic
979072432 4:116225000-116225022 ATGCATGTGAATATGCAAGCAGG + Intergenic
979503706 4:121468943-121468965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
980082318 4:128357185-128357207 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
983339255 4:166436757-166436779 ATGGATGTCAAGTTGGAGGATGG + Intergenic
983415215 4:167443595-167443617 ATTGATGTACATATGAAGGAGGG - Intergenic
983515530 4:168652264-168652286 AAGGATATAAAAATGGAGGAAGG + Intronic
983855164 4:172634091-172634113 ATGGAGGTGAATATGGAGTGTGG - Intronic
984126036 4:175812205-175812227 ATGGAAGAGAATATGGAAGAGGG - Exonic
984694446 4:182765617-182765639 ACGGAGGTGAGTAAGGAGGAAGG - Intronic
985427077 4:189841430-189841452 CTGGAGGGGAATGTGGAGGATGG - Intergenic
985529613 5:426294-426316 ATGGATGAGAAGATGATGGATGG + Intronic
985529716 5:426810-426832 ATAGATGGGAATATGATGGATGG + Intronic
985529748 5:426941-426963 ATGGATGGGAAGATGATGGATGG + Intronic
985529767 5:427020-427042 ATGGATGGGAAGATGATGGATGG + Intronic
986912080 5:12570374-12570396 GTGAATGTGAAGATGGAGGCAGG + Intergenic
987023544 5:13899878-13899900 ATGGATGTTAAGAGGGACGAGGG - Intronic
987103231 5:14611402-14611424 CTGGCTTTGAAGATGGAGGAAGG + Exonic
987243100 5:16021136-16021158 ATGGCTTTGAAGATGGAGGTGGG - Intergenic
987385482 5:17325110-17325132 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
987553931 5:19420684-19420706 ATGTATGTGTATGTGGAGGGGGG + Intergenic
988465498 5:31487333-31487355 ATACATGTGAAAATGAAGGAAGG + Intronic
989122746 5:38020648-38020670 ATGGATGGGAGTAGGGAGGCAGG - Intergenic
989366120 5:40657935-40657957 ATGGATGTGAGTTTGGGGGAGGG + Intergenic
990605618 5:57406949-57406971 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
990659884 5:58001549-58001571 CCGGATGTGAACATGGAGTAAGG - Intergenic
991159640 5:63483062-63483084 CTGGCTTTGAATATGGAGGTAGG - Intergenic
991236438 5:64404796-64404818 ATGGAAGTAAATGTGGAGAAAGG - Intergenic
992101043 5:73408043-73408065 AGGGATGTAAAAATGCAGGAAGG - Intergenic
992647871 5:78829014-78829036 CTGGCTTTGAAGATGGAGGAAGG + Intronic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
994048174 5:95332334-95332356 ATGCATGTGGGAATGGAGGAGGG + Intergenic
995060156 5:107804862-107804884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995140825 5:108733114-108733136 ATAGATGCTACTATGGAGGAGGG - Intergenic
995572565 5:113495740-113495762 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995783519 5:115803260-115803282 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996092096 5:119361436-119361458 ATGGTTTTGAAGATGGGGGAGGG + Intronic
996418265 5:123233481-123233503 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996470427 5:123853624-123853646 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996857897 5:128030567-128030589 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996970854 5:129366342-129366364 ATAGATATGGATATGGAGAAAGG + Intergenic
997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG + Intronic
997409161 5:133677358-133677380 ATGGATGTGGATATGGAATTGGG + Intergenic
999215865 5:149934594-149934616 ATGGCTGTGAATAAAGTGGATGG - Exonic
1001198270 5:169693155-169693177 ATGGAGGTCATTATGAAGGAAGG + Intronic
1001233910 5:170013528-170013550 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1001658161 5:173369983-173370005 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1002001129 5:176196810-176196832 CTGGGTGTGCATGTGGAGGAAGG - Intergenic
1002253206 5:177942162-177942184 CTGGGTGTGCATGTGGAGGAAGG + Intergenic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002349488 5:178573595-178573617 ATGAATGTGAATGTGAATGAAGG - Intronic
1002447690 5:179299724-179299746 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1002953759 6:1842051-1842073 GAGTATGTGAATATGGAGAATGG - Intronic
1004176905 6:13347982-13348004 ATGTCTGTGAACATGGAGGGTGG + Intergenic
1004315531 6:14583874-14583896 ATGGCCGTGGATATGGAGTAAGG + Intergenic
1004564439 6:16782139-16782161 ATGGATGTTAATAGAGAGAAGGG - Intergenic
1004565387 6:16791035-16791057 ATGGAAGTGAATATGGGCAAAGG + Intergenic
1004736826 6:18415182-18415204 ATGGATGTGAAATCTGAGGACGG + Intronic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1005784261 6:29226954-29226976 GTGGATGTGCATGTGGAAGAAGG - Intergenic
1006919065 6:37615641-37615663 ATGGATGGGAGTCTGGAGGTTGG - Intergenic
1006938678 6:37736847-37736869 ATGTATGTGAAAATGCAGCATGG + Intergenic
1007180456 6:39925857-39925879 ATGAATGGGAATGTGGAGGGAGG + Intronic
1007385584 6:41518216-41518238 CTGCATGTAAACATGGAGGAAGG + Intergenic
1007799816 6:44382515-44382537 ATGGATGGCAATCTGGTGGATGG + Intergenic
1008141697 6:47839464-47839486 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1008860980 6:56150024-56150046 ATCAATTTGGATATGGAGGAAGG - Intronic
1009816316 6:68740508-68740530 TTGGATGAGAATATGGTAGAAGG + Intronic
1009965829 6:70577077-70577099 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1010153332 6:72762298-72762320 AGGGAGGTGAAAAGGGAGGAGGG + Intronic
1010709136 6:79152398-79152420 AGGAATGTGAATATGAGGGAGGG - Intergenic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1011325161 6:86142688-86142710 CTAGCTTTGAATATGGAGGAAGG + Intergenic
1011510307 6:88093387-88093409 ATGGATGGGAAGCTGGAAGAAGG - Intergenic
1011555968 6:88571859-88571881 ATGTATGTGAAGATGATGGAAGG + Intergenic
1012867089 6:104631695-104631717 ATGGATGAGACTAGGGAAGAGGG + Intergenic
1013488791 6:110624235-110624257 AGGGATGTGGATAGGGAGGTGGG + Intronic
1013526249 6:110976533-110976555 CTGGCTTTGAATATGGAGGAAGG - Intergenic
1013622279 6:111901468-111901490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1013843082 6:114421249-114421271 ATGAATGTGAAGGTGGAGGGTGG + Intergenic
1013993605 6:116281203-116281225 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1014212288 6:118719832-118719854 AAGGATGGGAATGTGGAGCAAGG - Intergenic
1014451983 6:121592399-121592421 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1014539085 6:122652364-122652386 ATTTATGTGATTATGGAGGCTGG + Intronic
1015070370 6:129086943-129086965 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1015097183 6:129429731-129429753 AGGGCTGGGAATAGGGAGGAAGG + Intronic
1015186039 6:130417025-130417047 ATGGAAGTGAATATCAAGGTGGG - Intronic
1016341322 6:143064350-143064372 CTGGGTTTGAAGATGGAGGATGG + Intronic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1016727950 6:147396964-147396986 TTAGATGTGAGTGTGGAGGAAGG - Intergenic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1018249872 6:161858695-161858717 ATGGGTTAGAATAAGGAGGAAGG - Intronic
1018332729 6:162748707-162748729 AGGGATGTGAACCTGGGGGAGGG - Intronic
1018529730 6:164750009-164750031 ATGGATGTGATTATTGCAGATGG + Intergenic
1019362498 7:612137-612159 ATGGATGTAAGGATGGATGATGG + Intronic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019871445 7:3767184-3767206 CTGGAGGTGACTATGGAGGGAGG + Intronic
1020571424 7:9868265-9868287 ATGGCTTTGAAAATGGGGGAAGG - Intergenic
1021209016 7:17821822-17821844 ATGGATGTGAATATGGAGGATGG - Intronic
1021787713 7:24169021-24169043 CTGGCTTTGAAGATGGAGGAGGG - Intergenic
1021881042 7:25095794-25095816 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1022828225 7:34038313-34038335 ATAGCTTTGAAGATGGAGGAGGG + Intronic
1022982317 7:35615759-35615781 TTGTATGTGAGGATGGAGGAGGG - Intergenic
1023030658 7:36087982-36088004 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1023994687 7:45152045-45152067 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1024136436 7:46413353-46413375 ATGGCTATGAATAGGGAGGGAGG + Intergenic
1027428835 7:78088991-78089013 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1027858786 7:83548147-83548169 ATAGATGTGAAAATGGAGAAAGG - Intronic
1027987884 7:85318128-85318150 ATGTAGGTGGATATGGTGGAAGG + Intergenic
1028150624 7:87367288-87367310 ATGGCTTTGAAGATGGAAGAAGG + Intronic
1028163300 7:87509964-87509986 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1029786618 7:102798210-102798232 AGGGAAGTAAATAAGGAGGAAGG + Intronic
1030115374 7:106058762-106058784 ATGGAAGTCAGTATGGAGGATGG - Intergenic
1030360534 7:108590628-108590650 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1030805402 7:113912140-113912162 GTACATGTGTATATGGAGGATGG - Intronic
1031647829 7:124248602-124248624 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1031995214 7:128226277-128226299 ATGGATGGGAGGATGGATGATGG - Intergenic
1031995222 7:128226308-128226330 ATGGATGGGAGGATGGATGATGG - Intergenic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032361797 7:131262887-131262909 ATGTATGTGAGTGTGGAGAAAGG - Intronic
1032511513 7:132476122-132476144 ATGGATGTGTGTATGGAGAGGGG + Intronic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1032637596 7:133726872-133726894 ATGATTGTGAACATGGAGAATGG + Intronic
1032725174 7:134584386-134584408 ATGGATGGAAACATGAAGGACGG + Intergenic
1032864251 7:135910002-135910024 ATGGAAGTGAGGATGGAGAAAGG - Intergenic
1033052657 7:138020590-138020612 ATGGAGCTGAAGTTGGAGGATGG - Intronic
1033406909 7:141078746-141078768 TTGGAGGTGGATGTGGAGGAAGG + Intronic
1033436795 7:141340126-141340148 TTGGCTTTGAATATGGAGGAAGG + Intronic
1033858922 7:145600369-145600391 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1035279155 7:157766347-157766369 ATGGATGGGTAGATGGATGATGG - Intronic
1035905386 8:3503922-3503944 ATGAGTGAGAATATGGAGGCGGG + Intronic
1036092513 8:5682679-5682701 AGTGATGTGAATATGCAGGAAGG - Intergenic
1036189833 8:6660300-6660322 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1036282276 8:7410742-7410764 CTGGATTTGAAGATGAAGGAAGG - Intergenic
1036339192 8:7900828-7900850 CTGGATTTGAAGATGAAGGAAGG + Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1037443883 8:18945386-18945408 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1038264119 8:26023894-26023916 ATGGATTGGAACATGGAGAATGG - Intronic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1038671820 8:29589168-29589190 ATGGAAGTGAAAGTGGAGGTGGG + Intergenic
1039256161 8:35721212-35721234 AGGTGTGTGAAAATGGAGGATGG - Intronic
1040016028 8:42700872-42700894 GTGGATGTTGATATGGAGGTGGG + Intronic
1040987257 8:53309368-53309390 ATGGGTATGGATATGGAGAAAGG - Intergenic
1041118136 8:54560431-54560453 ATGGATGCGGATGTGGAGGCAGG + Intergenic
1041337339 8:56801100-56801122 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1041674685 8:60526354-60526376 TTGGTTGTGAAGATGGAGGAAGG - Intronic
1042372296 8:68005621-68005643 ATGCATGGGAATATCTAGGAAGG - Intronic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1042773299 8:72402225-72402247 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1043404334 8:79915423-79915445 ATGGACATGAATATGGGAGAAGG + Intergenic
1043662895 8:82768014-82768036 ATAGAAGTGAATATGGAGCTGGG - Intergenic
1044341765 8:91054259-91054281 TTGGCTTTGAAGATGGAGGAGGG - Intergenic
1044398657 8:91743996-91744018 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1044875218 8:96658746-96658768 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1044879442 8:96708097-96708119 ATGGCTTGGAAGATGGAGGAAGG - Intronic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1046711549 8:117516972-117516994 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1047774405 8:128057680-128057702 ATGGATGTCAAAATGCAGGGAGG - Intergenic
1048903937 8:139068754-139068776 ACGGCTTTGAAAATGGAGGAAGG - Intergenic
1048989298 8:139751961-139751983 ATGGATGTGTGAATGGTGGATGG - Intronic
1048989426 8:139752588-139752610 ATGGATGTGTGAATGGTGGATGG - Intronic
1049318626 8:141983543-141983565 ATGGATGTGAATGTGGTCTATGG - Intergenic
1049350698 8:142163007-142163029 ATTGATGTATAGATGGAGGATGG + Intergenic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049632661 8:143666978-143667000 ATGTATGTGCACATGGAGGAAGG - Intergenic
1050931113 9:11327990-11328012 ATGGCTTTGAAGATGGAAGAAGG - Intergenic
1051227725 9:14919792-14919814 ATAGCCTTGAATATGGAGGATGG - Intergenic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1051627476 9:19112069-19112091 ATGGAAGTGAGTGTTGAGGATGG - Intronic
1052016930 9:23479612-23479634 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1052202416 9:25799124-25799146 ATGGAGGGGACTGTGGAGGACGG - Intergenic
1053047797 9:34934985-34935007 AAGGATGTGAATATAGATAAAGG + Intergenic
1053294998 9:36906401-36906423 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1055110115 9:72551055-72551077 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1055427046 9:76207020-76207042 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1055795190 9:79968214-79968236 ATCGCTTTGAAGATGGAGGAAGG - Intergenic
1056843462 9:90017681-90017703 ATGGATGGGTCTATGGAGGTGGG + Intergenic
1057533318 9:95874658-95874680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1057858770 9:98623636-98623658 CTGGCTTTGAAAATGGAGGAAGG - Intronic
1058286389 9:103185010-103185032 ATGGTTTTGAAGATGGAGAAAGG + Intergenic
1058897917 9:109416032-109416054 CTAGATCTGAATGTGGAGGAAGG - Intronic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1059462575 9:114443443-114443465 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1060112645 9:120917703-120917725 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1060733235 9:126050782-126050804 AGGGGTGTGGAGATGGAGGACGG + Intergenic
1061244857 9:129396309-129396331 ATGGATGAGATGATGGATGAAGG + Intergenic
1061244988 9:129397005-129397027 ATGGATGGAAGGATGGAGGATGG + Intergenic
1061245102 9:129397533-129397555 ATGGATGGGTAGATGGATGATGG + Intergenic
1061292493 9:129659312-129659334 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1061951255 9:133937322-133937344 GTGGGTGTGAACATGGAAGACGG + Intronic
1062087552 9:134656720-134656742 ATGGCTGTTAATACGGAGGTTGG + Intronic
1185744350 X:2560044-2560066 ATGGATGTATATATGGATGATGG + Intergenic
1185744368 X:2560175-2560197 ATGGATGGATATATGGATGATGG + Intergenic
1185837418 X:3358106-3358128 ATAGATGGATATATGGAGGATGG - Intergenic
1186052616 X:5614938-5614960 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186151702 X:6681382-6681404 TTGGAAGGGAATATGGAGGTGGG - Intergenic
1186421050 X:9426761-9426783 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1186513217 X:10146784-10146806 TTGGATGTGAATTTGGAGGGGGG - Intergenic
1186584756 X:10860994-10861016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186624976 X:11283729-11283751 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1186656569 X:11618095-11618117 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1186689977 X:11964943-11964965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186698622 X:12065526-12065548 ATGGAAGTGGAGAGGGAGGAAGG - Intergenic
1187123595 X:16432919-16432941 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1187146807 X:16644596-16644618 CTGGCTTTGAAGATGGAGGATGG + Intronic
1187504077 X:19864540-19864562 GTGGCTTTGAAGATGGAGGAAGG + Intronic
1187719855 X:22139109-22139131 ATGGATGTGAAAACTGAGGGTGG - Intronic
1188095126 X:26011891-26011913 CTGGAGTTGAAAATGGAGGAAGG - Intergenic
1188117962 X:26268261-26268283 GTGGCTTTGAAAATGGAGGAAGG - Intergenic
1188231683 X:27671475-27671497 AAGGATGTGAATTTGGAATATGG - Intronic
1188577132 X:31664958-31664980 ATGAAAGTGAATATGTAGGTAGG - Intronic
1188738126 X:33742791-33742813 ATGGAGGGGATTATGGCGGATGG - Intergenic
1189069630 X:37849609-37849631 CTGGCTTTGAATTTGGAGGAAGG - Intronic
1189161552 X:38814214-38814236 CTGGCTGTGAAGATGGAAGAAGG + Intergenic
1190118603 X:47642016-47642038 TTGGCTTTGAAGATGGAGGAAGG + Intronic
1190516998 X:51234167-51234189 TTGGCTTTGAATATAGAGGAAGG + Intergenic
1190576380 X:51843462-51843484 ATGGCTTTGAAGATGGAGGAAGG + Intronic
1191801942 X:65091243-65091265 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1192075275 X:67988807-67988829 ATGTATGTGTATATGGAGAGAGG + Intergenic
1194454978 X:94092454-94092476 ATAGCTTTGAAGATGGAGGAAGG + Intergenic
1194852971 X:98891762-98891784 ATGGATGGGAAGATGGAAGAAGG - Intergenic
1195348051 X:103971012-103971034 ATTCATGTGATTATGGAGGCTGG + Intergenic
1195355533 X:104036315-104036337 ATTCATGTGATTATGGAGGCTGG + Intergenic
1195359391 X:104067829-104067851 ATTCATGTGATTATGGAGGCTGG - Intergenic
1196338045 X:114562174-114562196 ATGGAGATGAATATTGGGGATGG + Intergenic
1196651548 X:118173276-118173298 CTGGATGTTGTTATGGAGGAGGG - Intergenic
1197321710 X:125040235-125040257 ATGAATGTGAATATTTAGGAGGG - Intergenic
1197333487 X:125182179-125182201 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1197610896 X:128637063-128637085 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1197748362 X:129948123-129948145 TTGGATCTGAATGTGGGGGATGG + Intergenic
1198364586 X:135928028-135928050 ATGGTTGGGAATATGAAGCAGGG + Intergenic
1199424783 X:147688518-147688540 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1199467115 X:148150782-148150804 AAGGAAGTTAATATGGAGAAAGG - Intergenic
1199691083 X:150309468-150309490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1199803199 X:151271393-151271415 ATGGATGTGATTATGGCCTATGG + Intergenic