ID: 1021209298

View in Genome Browser
Species Human (GRCh38)
Location 7:17825694-17825716
Sequence AATTCTCGTTAAATCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021209298_1021209299 15 Left 1021209298 7:17825694-17825716 CCAGAAAAGATTTAACGAGAATT 0: 1
1: 0
2: 3
3: 15
4: 185
Right 1021209299 7:17825732-17825754 AGCTAGACCCAAGAACAAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 166
1021209298_1021209302 25 Left 1021209298 7:17825694-17825716 CCAGAAAAGATTTAACGAGAATT 0: 1
1: 0
2: 3
3: 15
4: 185
Right 1021209302 7:17825742-17825764 AAGAACAAAGAGGAAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021209298 Original CRISPR AATTCTCGTTAAATCTTTTC TGG (reversed) Intronic