ID: 1021209299

View in Genome Browser
Species Human (GRCh38)
Location 7:17825732-17825754
Sequence AGCTAGACCCAAGAACAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021209298_1021209299 15 Left 1021209298 7:17825694-17825716 CCAGAAAAGATTTAACGAGAATT 0: 1
1: 0
2: 3
3: 15
4: 185
Right 1021209299 7:17825732-17825754 AGCTAGACCCAAGAACAAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021209299 Original CRISPR AGCTAGACCCAAGAACAAAG AGG Intronic