ID: 1021209565

View in Genome Browser
Species Human (GRCh38)
Location 7:17830534-17830556
Sequence GTAGATTATCTTGAAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021209564_1021209565 -7 Left 1021209564 7:17830518-17830540 CCTCTTATTCTTGGTGGTAGATT 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1021209565 7:17830534-17830556 GTAGATTATCTTGAAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021209565 Original CRISPR GTAGATTATCTTGAAAACAC TGG Intronic
No off target data available for this crispr