ID: 1021214740

View in Genome Browser
Species Human (GRCh38)
Location 7:17901609-17901631
Sequence AGGGAGAGCACAGTGATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 2, 1: 27, 2: 82, 3: 187, 4: 413}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021214740_1021214747 25 Left 1021214740 7:17901609-17901631 CCCATAATCACTGTGCTCTCCCT 0: 2
1: 27
2: 82
3: 187
4: 413
Right 1021214747 7:17901657-17901679 TGCACCACTCAGCTTCTGCCAGG No data
1021214740_1021214748 26 Left 1021214740 7:17901609-17901631 CCCATAATCACTGTGCTCTCCCT 0: 2
1: 27
2: 82
3: 187
4: 413
Right 1021214748 7:17901658-17901680 GCACCACTCAGCTTCTGCCAGGG 0: 1
1: 0
2: 2
3: 37
4: 441
1021214740_1021214749 27 Left 1021214740 7:17901609-17901631 CCCATAATCACTGTGCTCTCCCT 0: 2
1: 27
2: 82
3: 187
4: 413
Right 1021214749 7:17901659-17901681 CACCACTCAGCTTCTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021214740 Original CRISPR AGGGAGAGCACAGTGATTAT GGG (reversed) Intronic