ID: 1021219765

View in Genome Browser
Species Human (GRCh38)
Location 7:17962519-17962541
Sequence GAGCCCAAAGTGCTACAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021219765 Original CRISPR GAGCCCAAAGTGCTACAGGC GGG Intergenic
901028392 1:6291604-6291626 GAGCCCAGGGAGCTACTGGCAGG - Intronic
905348423 1:37327637-37327659 GGGCCCAGAGTGCTGCAAGCTGG - Intergenic
905695425 1:39970031-39970053 GAGCCCCAGGTGCTACTGGGTGG + Intergenic
906206787 1:43991453-43991475 GAGCCCAAAGTGCTTGGGTCAGG + Intronic
906610502 1:47198587-47198609 GAGACCAAAGAGCTACTGGAGGG + Intergenic
908316237 1:62935466-62935488 GAACACAAAGTGGTACAGGCTGG - Intergenic
908317637 1:62948999-62949021 GACCCCCATCTGCTACAGGCAGG - Intergenic
908771996 1:67605970-67605992 CATCACAAAGTGCTACAGACTGG + Intergenic
910277929 1:85467929-85467951 GATAACAAAGTGCTACAGGAAGG + Intronic
914808952 1:151012543-151012565 GAGCCACAAGTGCTAGAAGCTGG + Intronic
920831116 1:209466696-209466718 TAGCTCACAGTTCTACAGGCTGG + Intergenic
922524784 1:226292414-226292436 CCTCCCAAAGTGCTACAGGCGGG + Intronic
922600362 1:226846835-226846857 GAGTCCCAAATTCTACAGGCAGG + Intergenic
922730262 1:227945782-227945804 GGGCACAAAGGGCTCCAGGCTGG - Intronic
922738844 1:228004700-228004722 GAGCCCCACGTGGTACAGGCAGG + Intergenic
1063561329 10:7130690-7130712 CAGCCCACAGTCCTAAAGGCCGG + Intergenic
1067524391 10:47029380-47029402 GGGCCCAAAGTGCTGCCGTCTGG + Intergenic
1068994440 10:63186509-63186531 GAGCCCAAAGGGTGACAGTCAGG - Intronic
1070102219 10:73399130-73399152 GACTCCAAAGTGCTAAAGGATGG + Intronic
1071738808 10:88333035-88333057 CAGCCTAAAGTCATACAGGCAGG - Intronic
1072538626 10:96381671-96381693 CACCCCACAGTGCTCCAGGCTGG + Intronic
1075603126 10:123785400-123785422 GAGTCCCAAGTGATACAGGTTGG - Intronic
1076244704 10:128937689-128937711 GACCCTAGAGTCCTACAGGCTGG - Intergenic
1083871765 11:65492699-65492721 CAGCCCACAGTGCTACAGCTGGG + Intergenic
1084029964 11:66475607-66475629 GAGTCCAACGTGCTGCAGGACGG + Exonic
1084830380 11:71764062-71764084 GAGGCCACAGTGAGACAGGCAGG - Intergenic
1085729010 11:78980531-78980553 GAGCCCAAGGTCCTATAGGAAGG + Intronic
1086900974 11:92367121-92367143 GAAGGCAAAGTGCTACAGGCAGG - Intronic
1092720247 12:11433909-11433931 CTGCCTAAAGTGCTACAGCCAGG - Intronic
1095290198 12:40469965-40469987 GAGCACAAAATGTTACAGCCCGG + Intronic
1100493367 12:95102047-95102069 CCTCCCAAAGTGCTACAGGCAGG - Intronic
1102919117 12:116778528-116778550 TAGCCCAGGGTTCTACAGGCTGG - Intronic
1102973816 12:117191640-117191662 GAGACAAAAGTGCTAAAGCCTGG + Intergenic
1103621095 12:122187762-122187784 TAACCCCAAGTGCTGCAGGCCGG - Exonic
1104414551 12:128587255-128587277 GAGCTCACAGTTCTGCAGGCTGG + Intronic
1106551889 13:30779249-30779271 TAGCTCATAGTTCTACAGGCTGG - Intergenic
1113102476 13:106735519-106735541 GAGCCCAAGGTGCTCCACGGAGG + Intergenic
1113415595 13:110126092-110126114 GACTCCAAAGTCCTACAGGCAGG - Intergenic
1114401641 14:22415759-22415781 GAGTCCAGTGCGCTACAGGCTGG + Intergenic
1119359862 14:74040039-74040061 GAGCCCACATTGCTCCAGCCTGG - Intronic
1119804540 14:77474422-77474444 GAGCCCAGAGAGCTTCAGGGCGG + Exonic
1120089338 14:80312772-80312794 AAACCCAAAATGCTCCAGGCCGG - Intronic
1120586620 14:86319884-86319906 GAGCCCAAAGTTATAGAGGAAGG - Intergenic
1122347126 14:101067514-101067536 GAGACCCAAGTGCCACAGGCTGG - Intergenic
1126455904 15:48861728-48861750 GAGCCCATCCTGCTACAGGTGGG - Intronic
1126693767 15:51308655-51308677 GACCCCAAAGTCTTAGAGGCCGG + Intronic
1126773142 15:52077463-52077485 GAGACAAAAGTGCTTCAGCCTGG + Intergenic
1131155889 15:90075181-90075203 GAGCCAACAGCGCTACAGGGAGG + Intronic
1132279730 15:100602592-100602614 GACCCCAAAGTGCTGAAGGGAGG + Exonic
1136374309 16:29856286-29856308 GAGCACCAAGTGCTCCAGGGAGG - Intergenic
1137444350 16:48522751-48522773 GGGCCCAGAGTGCTAAAGACAGG + Intergenic
1142400352 16:89855348-89855370 GAGTCCCAGGTGCTAGAGGCTGG + Intronic
1142557827 17:791551-791573 GAGCCCAAAGTGCTCCGGGCGGG + Exonic
1146536667 17:33658516-33658538 GTGCTCACAGTTCTACAGGCTGG + Intronic
1146991387 17:37276074-37276096 GAGGCCAAGGTGTTACAGTCAGG - Intronic
1152264746 17:79287744-79287766 GAGCCCACAGGGGTCCAGGCAGG + Intronic
1154989237 18:21584738-21584760 GAGCCCAAGGAGATAGAGGCTGG + Intronic
1156546130 18:37965421-37965443 CAGCCCAAAGTGTGACAGGCAGG + Intergenic
1157703326 18:49779399-49779421 TAGCCCACAGTCCTAAAGGCTGG + Intergenic
1161734941 19:5985996-5986018 GAGCCCAGAGTGCCACAGCCGGG + Intergenic
1164979140 19:32600241-32600263 AAGCCTAAAATGCCACAGGCTGG + Intronic
925131803 2:1499082-1499104 GACCCCAAAGTGCTACTCACAGG + Intronic
926059037 2:9793848-9793870 CAGCCCAAAGTGCCACAGCTCGG + Intergenic
926314434 2:11698878-11698900 GAGGCACAAGTTCTACAGGCAGG - Intronic
927355922 2:22173151-22173173 AAGTCTCAAGTGCTACAGGCTGG - Intergenic
928403631 2:30997274-30997296 GAGCCCAAAGTGCCACAGGAGGG + Intronic
934565996 2:95341579-95341601 TAGCCCACTGTGCAACAGGCAGG + Intronic
938996353 2:136683094-136683116 CAGCCCACAGTCCTAAAGGCTGG - Intergenic
940423760 2:153508533-153508555 CAGCCCACAGTCCTAAAGGCTGG + Intergenic
941268395 2:163393249-163393271 GAAACCAAAGTGATATAGGCAGG - Intergenic
948412316 2:237773675-237773697 GGGCCCAGGGTGCTAGAGGCAGG - Intronic
1172013454 20:31859827-31859849 GAGCCCGCAGTCCTCCAGGCTGG - Intronic
1173223244 20:41146319-41146341 GTGCCTAAAGTGCTGTAGGCTGG + Intronic
1173739176 20:45384642-45384664 CATCCCAAAATTCTACAGGCAGG - Intronic
1174185684 20:48704343-48704365 GAGCCCAAAGCACTCCAGGGAGG + Intronic
1175286268 20:57838936-57838958 GAGAGGAATGTGCTACAGGCGGG + Intergenic
1178855393 21:36246171-36246193 GAGCCAGAAGCGCTACGGGCTGG + Exonic
1179467876 21:41589750-41589772 CAGCCCACAGTCCTAAAGGCTGG + Intergenic
1180613405 22:17111991-17112013 GAGCCCAAAAGGCTAGTGGCTGG - Exonic
1181041302 22:20193945-20193967 GAGCCCACAGCCCTGCAGGCCGG + Intergenic
1181463370 22:23098107-23098129 GAGCCAAGAGGGCTGCAGGCAGG - Intronic
1184147754 22:42621442-42621464 GAGCCCCAAGGACTCCAGGCAGG - Intronic
1184839094 22:47042178-47042200 GAGCCCAAAGTGCCTCATGGGGG - Intronic
953905473 3:46866327-46866349 CAGCCCAGTGTGCTGCAGGCTGG + Intronic
959757371 3:109914977-109914999 CAGCCCACAGTCCTAAAGGCCGG + Intergenic
962949709 3:140206474-140206496 GAGCTTGAAGTGCTTCAGGCTGG + Intronic
963373905 3:144438241-144438263 CAGCCCACAGTCCTAAAGGCTGG + Intergenic
963832441 3:150022816-150022838 CAGCCCACAGTCCTAAAGGCTGG - Intronic
964393128 3:156218166-156218188 CAGCCCACAGTCCTAAAGGCCGG - Intronic
965101562 3:164305822-164305844 CAGCCCAAAGTCCTAAAGGCTGG - Intergenic
969285206 4:6198824-6198846 CAGCCCAGGGTGCTACAGGAAGG + Intronic
969507054 4:7594574-7594596 GAGCCCAGAGTCCTAGAGCCAGG - Intronic
970570338 4:17374885-17374907 GAGTCCACAGGGCTACAGGTAGG + Intergenic
972442896 4:39114183-39114205 TAGCCCACAGTTCTCCAGGCTGG + Intronic
979091028 4:116482769-116482791 GGACCCAAAGTGCTACATTCAGG + Intergenic
980452549 4:132993662-132993684 TAGCTCAAAGATCTACAGGCTGG + Intergenic
984983251 4:185302907-185302929 GAGCCCACAGACCTTCAGGCAGG - Intronic
986072953 5:4305140-4305162 GAGCCCAAAGAGGAACAGGGAGG + Intergenic
986215999 5:5719805-5719827 GATAACAAAGTGCCACAGGCCGG + Intergenic
986774698 5:11003267-11003289 AAGCCCTGAGTGTTACAGGCTGG - Intronic
988421222 5:31008256-31008278 TAGCCCACAGTCCTAAAGGCTGG + Intergenic
991772091 5:70049941-70049963 GAGCCCAAACTGCTCGAGGAAGG - Intronic
991851384 5:70925359-70925381 GAGCCCAAACTGCTCGAGGAAGG - Intronic
992162367 5:74015852-74015874 GAGTCAAAACTCCTACAGGCTGG - Intergenic
992822185 5:80508604-80508626 GCTCCCAAATTTCTACAGGCAGG - Intronic
992948291 5:81831267-81831289 AAGCCCAAAGTGCTTCTGCCAGG - Intergenic
998153300 5:139769479-139769501 GAGCCACAAGTGCTACAGCCTGG - Intergenic
999833295 5:155341457-155341479 GAGCCCACAGTGCAGCAGGAAGG + Intergenic
1002586515 5:180252210-180252232 GCGCCCACACTGCTGCAGGCTGG - Intronic
1003527717 6:6911752-6911774 CAGCCCAACCTGCAACAGGCTGG + Intergenic
1004538134 6:16522779-16522801 AAGGCCAAAGTGCTAGGGGCTGG - Intronic
1004931754 6:20468993-20469015 GAGGCCAGAGAGCTTCAGGCAGG + Intronic
1007160881 6:39791075-39791097 TAGCCCAAACTGGTAGAGGCGGG - Intergenic
1007201157 6:40110395-40110417 GAGCCTAGAGTTCTACAGGGAGG - Intergenic
1007727692 6:43926506-43926528 GAGCCCCAAGGACCACAGGCTGG - Intergenic
1014962718 6:127706811-127706833 GAGCAAAAAGTGTTCCAGGCAGG + Intergenic
1018350287 6:162951374-162951396 GAGCCCAGATTGACACAGGCAGG + Intronic
1018755252 6:166843059-166843081 CAGCCCACAGTCCTAAAGGCTGG - Intronic
1020750675 7:12137281-12137303 GAGTCCAAAGTGAAAGAGGCAGG + Intergenic
1021219765 7:17962519-17962541 GAGCCCAAAGTGCTACAGGCGGG + Intergenic
1025085467 7:56019844-56019866 GAGCCCAGTGTGCAACAGACAGG + Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028501813 7:91527523-91527545 TAGCCCACAGTCCTAAAGGCTGG - Intergenic
1030533443 7:110737352-110737374 AAGCCCATAGTCCTAAAGGCTGG - Intronic
1032085473 7:128881290-128881312 GAGCCCAAAGGGCCAGAGGCTGG + Intronic
1032297067 7:130648852-130648874 GAGCCCCAAATTCTATAGGCAGG - Intronic
1035659540 8:1336427-1336449 GAGCCCAGACTTCTACCGGCCGG - Intergenic
1042431374 8:68710452-68710474 CAGCCCATAGTCCTAAAGGCTGG - Intronic
1043545089 8:81306511-81306533 CAGCCCATAGTCCTAAAGGCCGG - Intergenic
1047491941 8:125382383-125382405 TAGCCCACAGTTCTAGAGGCTGG + Intergenic
1048442241 8:134468714-134468736 GAGCGCAGAGTGTTCCAGGCAGG + Intergenic
1053239609 9:36486183-36486205 GAGAGCAACGTGTTACAGGCAGG - Intronic
1055526320 9:77137487-77137509 CAGCTCACAGTTCTACAGGCTGG + Intergenic
1055912033 9:81364081-81364103 TAGCCCACAGTCCTAAAGGCTGG - Intergenic
1056396572 9:86186821-86186843 CAGCCCACAGTCCTAGAGGCTGG - Intergenic
1057856224 9:98602866-98602888 GAGTCCAGTATGCTACAGGCAGG + Intronic
1060795271 9:126508679-126508701 GATCCCAAAGGGCTCCAGGTGGG - Intergenic
1061401496 9:130370773-130370795 GAGCCCATGGCGCCACAGGCTGG - Intronic
1185897049 X:3867970-3867992 GAAACCACAGTGATACAGGCCGG + Intergenic
1185902168 X:3906396-3906418 GAAACCACAGTGATACAGGCCGG + Intergenic
1186761421 X:12726829-12726851 GCGTCCTAAGTGCTACAGGTGGG + Intergenic
1190974824 X:55389088-55389110 GAGACAAAACTGCTACAGGGAGG + Intergenic
1192888912 X:75367104-75367126 GAGCCCAGAGGGCTGCTGGCTGG - Intergenic
1193599382 X:83490578-83490600 GAGGCCAAAGTGCTTGAGCCTGG + Intergenic
1195022528 X:100844397-100844419 GTGCCCAAAGTCCCACAGGTGGG - Intronic
1196023987 X:111020829-111020851 GAGCCCACAGTCCTAAAGGCCGG - Intronic
1196996457 X:121389059-121389081 TAGCACAAAGTGCTAGAGCCTGG + Intergenic
1200900703 Y:8429060-8429082 GAGCCAAAAGAGCTACAGAAAGG + Intergenic