ID: 1021221943

View in Genome Browser
Species Human (GRCh38)
Location 7:17984857-17984879
Sequence CGCTTGGGCCCGAGAGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021221943_1021221949 7 Left 1021221943 7:17984857-17984879 CCTCCGGCTCTCGGGCCCAAGCG No data
Right 1021221949 7:17984887-17984909 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947
1021221943_1021221951 8 Left 1021221943 7:17984857-17984879 CCTCCGGCTCTCGGGCCCAAGCG No data
Right 1021221951 7:17984888-17984910 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021221943 Original CRISPR CGCTTGGGCCCGAGAGCCGG AGG (reversed) Intergenic
No off target data available for this crispr