ID: 1021221944

View in Genome Browser
Species Human (GRCh38)
Location 7:17984860-17984882
Sequence GATCGCTTGGGCCCGAGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021221944_1021221951 5 Left 1021221944 7:17984860-17984882 CCGGCTCTCGGGCCCAAGCGATC No data
Right 1021221951 7:17984888-17984910 CCTCAGCCTCCTGAGTAGCTGGG No data
1021221944_1021221949 4 Left 1021221944 7:17984860-17984882 CCGGCTCTCGGGCCCAAGCGATC No data
Right 1021221949 7:17984887-17984909 ACCTCAGCCTCCTGAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021221944 Original CRISPR GATCGCTTGGGCCCGAGAGC CGG (reversed) Intergenic