ID: 1021221945

View in Genome Browser
Species Human (GRCh38)
Location 7:17984872-17984894
Sequence GCTGAGGTGGAGGATCGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021221945_1021221951 -7 Left 1021221945 7:17984872-17984894 CCCAAGCGATCCTCCACCTCAGC No data
Right 1021221951 7:17984888-17984910 CCTCAGCCTCCTGAGTAGCTGGG No data
1021221945_1021221949 -8 Left 1021221945 7:17984872-17984894 CCCAAGCGATCCTCCACCTCAGC No data
Right 1021221949 7:17984887-17984909 ACCTCAGCCTCCTGAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021221945 Original CRISPR GCTGAGGTGGAGGATCGCTT GGG (reversed) Intergenic