ID: 1021221946

View in Genome Browser
Species Human (GRCh38)
Location 7:17984873-17984895
Sequence GGCTGAGGTGGAGGATCGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021221946_1021221949 -9 Left 1021221946 7:17984873-17984895 CCAAGCGATCCTCCACCTCAGCC No data
Right 1021221949 7:17984887-17984909 ACCTCAGCCTCCTGAGTAGCTGG No data
1021221946_1021221951 -8 Left 1021221946 7:17984873-17984895 CCAAGCGATCCTCCACCTCAGCC No data
Right 1021221951 7:17984888-17984910 CCTCAGCCTCCTGAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021221946 Original CRISPR GGCTGAGGTGGAGGATCGCT TGG (reversed) Intergenic