ID: 1021221949

View in Genome Browser
Species Human (GRCh38)
Location 7:17984887-17984909
Sequence ACCTCAGCCTCCTGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 727067
Summary {0: 12610, 1: 113153, 2: 218440, 3: 237917, 4: 144947}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021221946_1021221949 -9 Left 1021221946 7:17984873-17984895 CCAAGCGATCCTCCACCTCAGCC No data
Right 1021221949 7:17984887-17984909 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947
1021221945_1021221949 -8 Left 1021221945 7:17984872-17984894 CCCAAGCGATCCTCCACCTCAGC No data
Right 1021221949 7:17984887-17984909 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947
1021221944_1021221949 4 Left 1021221944 7:17984860-17984882 CCGGCTCTCGGGCCCAAGCGATC No data
Right 1021221949 7:17984887-17984909 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947
1021221943_1021221949 7 Left 1021221943 7:17984857-17984879 CCTCCGGCTCTCGGGCCCAAGCG No data
Right 1021221949 7:17984887-17984909 ACCTCAGCCTCCTGAGTAGCTGG 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021221949 Original CRISPR ACCTCAGCCTCCTGAGTAGC TGG Intergenic
Too many off-targets to display for this crispr