ID: 1021221951

View in Genome Browser
Species Human (GRCh38)
Location 7:17984888-17984910
Sequence CCTCAGCCTCCTGAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021221943_1021221951 8 Left 1021221943 7:17984857-17984879 CCTCCGGCTCTCGGGCCCAAGCG No data
Right 1021221951 7:17984888-17984910 CCTCAGCCTCCTGAGTAGCTGGG No data
1021221946_1021221951 -8 Left 1021221946 7:17984873-17984895 CCAAGCGATCCTCCACCTCAGCC No data
Right 1021221951 7:17984888-17984910 CCTCAGCCTCCTGAGTAGCTGGG No data
1021221945_1021221951 -7 Left 1021221945 7:17984872-17984894 CCCAAGCGATCCTCCACCTCAGC No data
Right 1021221951 7:17984888-17984910 CCTCAGCCTCCTGAGTAGCTGGG No data
1021221944_1021221951 5 Left 1021221944 7:17984860-17984882 CCGGCTCTCGGGCCCAAGCGATC No data
Right 1021221951 7:17984888-17984910 CCTCAGCCTCCTGAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021221951 Original CRISPR CCTCAGCCTCCTGAGTAGCT GGG Intergenic