ID: 1021224681

View in Genome Browser
Species Human (GRCh38)
Location 7:18013464-18013486
Sequence TTAGTCCTGCCGTTCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021224681_1021224683 -1 Left 1021224681 7:18013464-18013486 CCTCCTGTGAACGGCAGGACTAA No data
Right 1021224683 7:18013486-18013508 ACAAAACGTATGAAGCAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021224681 Original CRISPR TTAGTCCTGCCGTTCACAGG AGG (reversed) Intergenic
No off target data available for this crispr