ID: 1021227070

View in Genome Browser
Species Human (GRCh38)
Location 7:18040269-18040291
Sequence AGCAAAGGGGTTTTTAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021227070_1021227075 12 Left 1021227070 7:18040269-18040291 CCTCATTTAAAAACCCCTTTGCT No data
Right 1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG No data
1021227070_1021227074 -1 Left 1021227070 7:18040269-18040291 CCTCATTTAAAAACCCCTTTGCT No data
Right 1021227074 7:18040291-18040313 TGAATAATCTCGTTTTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021227070 Original CRISPR AGCAAAGGGGTTTTTAAATG AGG (reversed) Intergenic
No off target data available for this crispr