ID: 1021227072

View in Genome Browser
Species Human (GRCh38)
Location 7:18040283-18040305
Sequence AAACGAGATTATTCAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021227072_1021227075 -2 Left 1021227072 7:18040283-18040305 CCCTTTGCTGAATAATCTCGTTT No data
Right 1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021227072 Original CRISPR AAACGAGATTATTCAGCAAA GGG (reversed) Intergenic
No off target data available for this crispr