ID: 1021227075

View in Genome Browser
Species Human (GRCh38)
Location 7:18040304-18040326
Sequence TTTGTCAAGGCCTTCATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021227073_1021227075 -3 Left 1021227073 7:18040284-18040306 CCTTTGCTGAATAATCTCGTTTT No data
Right 1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG No data
1021227070_1021227075 12 Left 1021227070 7:18040269-18040291 CCTCATTTAAAAACCCCTTTGCT No data
Right 1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG No data
1021227069_1021227075 13 Left 1021227069 7:18040268-18040290 CCCTCATTTAAAAACCCCTTTGC No data
Right 1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG No data
1021227072_1021227075 -2 Left 1021227072 7:18040283-18040305 CCCTTTGCTGAATAATCTCGTTT No data
Right 1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG No data
1021227071_1021227075 -1 Left 1021227071 7:18040282-18040304 CCCCTTTGCTGAATAATCTCGTT No data
Right 1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021227075 Original CRISPR TTTGTCAAGGCCTTCATTAT TGG Intergenic
No off target data available for this crispr