ID: 1021231723

View in Genome Browser
Species Human (GRCh38)
Location 7:18093207-18093229
Sequence AAGTCTCCACACACCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 256}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021231723_1021231732 21 Left 1021231723 7:18093207-18093229 CCCTGGCAGGTGTGTGGAGACTT 0: 1
1: 0
2: 4
3: 22
4: 256
Right 1021231732 7:18093251-18093273 AAGGGTCGTTCAGCTAGGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 63
1021231723_1021231730 18 Left 1021231723 7:18093207-18093229 CCCTGGCAGGTGTGTGGAGACTT 0: 1
1: 0
2: 4
3: 22
4: 256
Right 1021231730 7:18093248-18093270 GCCAAGGGTCGTTCAGCTAGGGG No data
1021231723_1021231726 2 Left 1021231723 7:18093207-18093229 CCCTGGCAGGTGTGTGGAGACTT 0: 1
1: 0
2: 4
3: 22
4: 256
Right 1021231726 7:18093232-18093254 AAAGGCTAAATACTTTGCCAAGG No data
1021231723_1021231728 16 Left 1021231723 7:18093207-18093229 CCCTGGCAGGTGTGTGGAGACTT 0: 1
1: 0
2: 4
3: 22
4: 256
Right 1021231728 7:18093246-18093268 TTGCCAAGGGTCGTTCAGCTAGG No data
1021231723_1021231729 17 Left 1021231723 7:18093207-18093229 CCCTGGCAGGTGTGTGGAGACTT 0: 1
1: 0
2: 4
3: 22
4: 256
Right 1021231729 7:18093247-18093269 TGCCAAGGGTCGTTCAGCTAGGG No data
1021231723_1021231733 28 Left 1021231723 7:18093207-18093229 CCCTGGCAGGTGTGTGGAGACTT 0: 1
1: 0
2: 4
3: 22
4: 256
Right 1021231733 7:18093258-18093280 GTTCAGCTAGGGGTGGCATTAGG 0: 1
1: 0
2: 0
3: 8
4: 85
1021231723_1021231727 3 Left 1021231723 7:18093207-18093229 CCCTGGCAGGTGTGTGGAGACTT 0: 1
1: 0
2: 4
3: 22
4: 256
Right 1021231727 7:18093233-18093255 AAGGCTAAATACTTTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021231723 Original CRISPR AAGTCTCCACACACCTGCCA GGG (reversed) Intronic
900868939 1:5288222-5288244 AATTCACCTCACACCTGCTATGG - Intergenic
901027840 1:6288373-6288395 AACTTGCCACACACCTGCTAAGG + Intronic
901531780 1:9858232-9858254 CATTCTCCACATAACTGCCAGGG + Intronic
902875699 1:19339604-19339626 AAGTCTGCACAGACCTGCAAGGG + Exonic
904496886 1:30892129-30892151 CAGAGTCCAAACACCTGCCAGGG + Intronic
905262653 1:36730536-36730558 AAGTCTCCACTTTCCTGCCTTGG - Intergenic
906441327 1:45848248-45848270 AAGTTTCCAGATACCAGCCAAGG - Intronic
909236761 1:73162341-73162363 AAGTTTCCAGACACCAGACAAGG - Intergenic
919792386 1:201300464-201300486 GAGCCTCAACTCACCTGCCATGG - Intronic
920737133 1:208542995-208543017 GAGTCTCCACATACCTGGCTCGG - Intergenic
921174124 1:212578986-212579008 AAGTCTCCAGAGAGCTGCCTGGG - Intronic
921937058 1:220804984-220805006 AAATCTCTACACACGTGTCAGGG + Intronic
923262990 1:232285029-232285051 GAGTCCCCACTCACCTGCTAAGG - Intergenic
923728950 1:236532221-236532243 AAGTTCCCAGACACCAGCCAGGG + Intronic
924113859 1:240726630-240726652 TGTTCTCCACACACCTTCCAAGG - Intergenic
924573712 1:245260354-245260376 AAACCTCCAAGCACCTGCCATGG - Intronic
1064348047 10:14550499-14550521 AAGTCTCAACACACCATCGAGGG + Intronic
1064392787 10:14955930-14955952 AGGTCTCCATAACCCTGCCAGGG - Intergenic
1065045730 10:21746480-21746502 ATGTCACCACACTCCAGCCAGGG + Intergenic
1065661779 10:28011092-28011114 ATGTCTCTACACTCTTGCCATGG - Intergenic
1066611622 10:37254724-37254746 AAGTCACCACACTCCAGCCTGGG - Intronic
1067004565 10:42648577-42648599 AAGTCTCCACTCCTCTGCCTTGG - Intergenic
1067355111 10:45516910-45516932 AGCTCTCCAGTCACCTGCCAAGG + Intronic
1067514571 10:46927039-46927061 AAGTTCCCAGACACCAGCCAAGG + Intronic
1067557956 10:47285474-47285496 AACTCTCCAGACACCTTCCATGG + Intergenic
1067647689 10:48124774-48124796 AAGTTCCCAGACACCAGCCAAGG - Intergenic
1069851450 10:71407800-71407822 AAGTCTTCACACACTTGCCAGGG - Intronic
1071270825 10:84005818-84005840 AATTCTCCACACTGCTGCCAAGG - Intergenic
1072498612 10:95989189-95989211 AGGTCTTCAGACACCTGCCTGGG - Intronic
1073740955 10:106406381-106406403 AAGTCTCCACACAGCAGCCAGGG - Intergenic
1073963933 10:108966562-108966584 AATTCTGCACACTTCTGCCAAGG + Intergenic
1076124903 10:127966247-127966269 AGGGCTCCACACACCTGCTGAGG - Intronic
1077481304 11:2815913-2815935 GAGTCGCCGCACACCTGTCAGGG + Intronic
1077777593 11:5288538-5288560 TTGTCTCCACACACCAGTCATGG + Intronic
1078487387 11:11736202-11736224 CATTCTCCACACAGCAGCCAGGG - Intergenic
1081044178 11:38250946-38250968 AAGTGTGCACACACCTGGCTGGG + Intergenic
1082217756 11:49595301-49595323 AGGTATACACACACGTGCCATGG - Intergenic
1082835286 11:57646784-57646806 ATGTCTCCACAGTCCTTCCAAGG - Exonic
1083137076 11:60689073-60689095 AAGCTTCCACATACCTGCCTAGG + Intergenic
1083207489 11:61161377-61161399 CAGTCTCCGCTCACCTGCCAGGG + Exonic
1083230450 11:61314510-61314532 ATGTCTCCAAGCATCTGCCAGGG + Intronic
1084874299 11:72119389-72119411 AAGTTTCTCCACACCAGCCAAGG - Intronic
1086631817 11:89028849-89028871 AGGTATACACACACGTGCCATGG + Intronic
1086945182 11:92837654-92837676 GAGTATCCAGACACCTGCCAAGG - Exonic
1089056353 11:115588685-115588707 AAGTCTCCTCTCCCCTTCCATGG + Intergenic
1089194811 11:116688070-116688092 AAGGCTCCACCCACCTGGCCTGG + Intergenic
1089331228 11:117690387-117690409 AAGTGACCACAGACCTCCCAAGG + Intronic
1090107299 11:123867078-123867100 TAATCGCCACACACCAGCCAAGG - Intergenic
1090727209 11:129538934-129538956 AGGTCTCCACTCAGCTACCATGG + Intergenic
1091592294 12:1850923-1850945 ATGTCACCACACTCCTGCCTGGG - Intronic
1092994945 12:13940914-13940936 GACTCTCCACACACCTTACAGGG + Intronic
1094042640 12:26133714-26133736 ACATCTGCACACAGCTGCCAGGG + Intronic
1094414583 12:30203138-30203160 AAGTCTCCAGACTTCAGCCATGG - Intergenic
1095813301 12:46394727-46394749 AAGTCTCCCAGTACCTGCCACGG + Intergenic
1096038268 12:48492062-48492084 AAGGCTCCTCACCCCTTCCATGG - Intronic
1097944990 12:65357689-65357711 ATGACTCCTCAAACCTGCCAAGG - Intronic
1099155322 12:79168094-79168116 AGGTCCCCAAACTCCTGCCAGGG - Intronic
1100353499 12:93807344-93807366 CACCCTCCACACACCTGACATGG - Intronic
1101071133 12:101076982-101077004 AAGTTCCCAGACACCAGCCAAGG - Intronic
1101535605 12:105613565-105613587 AAATCTCCACACACCCGCCCTGG - Intergenic
1101650587 12:106673921-106673943 AGTTCTCCACACAGCAGCCAGGG + Intronic
1103362858 12:120363835-120363857 AAGTCCCCCAACTCCTGCCAGGG - Intronic
1103928275 12:124435653-124435675 ACGTGCCCACACACCTGCCCAGG + Intronic
1104544225 12:129696672-129696694 CAGTCTCTACTTACCTGCCATGG - Intronic
1104792591 12:131493295-131493317 CAGCCTCCTCACACCTGCCCGGG - Intergenic
1106253585 13:28002101-28002123 AAGTGCGCACACACCTGGCAGGG + Intergenic
1107068571 13:36244191-36244213 AAGTTTCCAGATACCAGCCAAGG - Intronic
1113941307 13:114019827-114019849 CAGGCTCCACCCACCTGACAGGG - Intronic
1113941328 13:114019907-114019929 CAGGCTCCACCCACCTGACAGGG - Intronic
1113941361 13:114020026-114020048 CAGGCTCCACCCACCTGACAGGG - Intronic
1113941394 13:114020145-114020167 CAGGCTCCACCCACCTGACAGGG - Intronic
1113941415 13:114020225-114020247 CAGGCTCCACCCACCTGACAGGG - Intronic
1115004835 14:28468908-28468930 GGGGCTCCACACTCCTGCCATGG - Intergenic
1115153526 14:30312813-30312835 AAGTCTATCCACACCTGTCAAGG - Intergenic
1122079438 14:99256829-99256851 AAGTTCCCACACCCCTGCCTGGG + Intronic
1122651896 14:103230883-103230905 ATGTGTCCAGACCCCTGCCAGGG - Intergenic
1123089859 14:105737708-105737730 CAGACCCCACACACCAGCCATGG - Intergenic
1123966996 15:25469061-25469083 ACATGTCCACACACATGCCAGGG - Intergenic
1124590916 15:31052094-31052116 AGGACTCTGCACACCTGCCATGG + Intronic
1127321499 15:57851133-57851155 GAGTCTCCAAACATTTGCCAAGG + Intergenic
1127475409 15:59328014-59328036 AAGCCTCCACACTTCTGCCCAGG - Intronic
1128694365 15:69749384-69749406 CTGTCTCCACACGCCAGCCATGG + Intergenic
1129853560 15:78809646-78809668 AACTCTTCCCACAGCTGCCAGGG + Intronic
1129905895 15:79186837-79186859 CAGTCTCCCCTCAGCTGCCATGG - Intergenic
1131878761 15:96839562-96839584 AAGTGTCCACACACATGAAAAGG + Intergenic
1132995190 16:2819085-2819107 CAGTCTCTCCTCACCTGCCAGGG + Intronic
1135207313 16:20494182-20494204 AAGTCTCTATATACCTGTCAGGG - Intergenic
1135211572 16:20529450-20529472 AAGTCTCTATATACCTGTCAGGG + Intergenic
1136504169 16:30692210-30692232 ATGTCTCCACACAGCAGCCAGGG - Intergenic
1139658629 16:68404906-68404928 AAGTCTGCACACATGTGCCTGGG - Intronic
1140310909 16:73847441-73847463 AAGTCTACAAATGCCTGCCAAGG - Intergenic
1142477490 17:198034-198056 GAGTCTACACAGACCTGCAAGGG + Intergenic
1143706971 17:8705389-8705411 CATTCTCCACACAACAGCCAGGG + Intergenic
1143796362 17:9340154-9340176 AATTCTCCAAACACCTGCCGAGG + Intronic
1143831935 17:9659508-9659530 AAGTCTCCTCTCTCCCGCCATGG - Intronic
1143886543 17:10069153-10069175 AAGTTCCCAGACACCAGCCAAGG + Intronic
1143921567 17:10334288-10334310 ATGTCTCCCCACAGCTACCAGGG - Intronic
1144737414 17:17562921-17562943 ACGTCCCCACCCACCTGACAAGG + Intronic
1146157322 17:30535359-30535381 CGATCTCCACACACCTGCCCAGG - Intergenic
1146423078 17:32707631-32707653 AAGTTCCCAGACACCAGCCAAGG - Intronic
1147791492 17:43016640-43016662 AATTCTCCACACCAGTGCCAGGG + Intronic
1148867542 17:50636602-50636624 CAGGCACCACAAACCTGCCACGG - Intronic
1149386707 17:56149763-56149785 ATGTGTCTACACACCTGGCATGG + Intronic
1150157824 17:62868983-62869005 AAGTCTCCAGCCAACAGCCAGGG + Intergenic
1152330808 17:79671510-79671532 AAGGCTCCACACATCTCCCCTGG + Intergenic
1156280712 18:35634827-35634849 AAGTTTCCACATGCCAGCCAAGG + Intronic
1157575233 18:48739091-48739113 AAGTCTTCTCCCACCTCCCAGGG + Intronic
1157729814 18:49993783-49993805 AATTCTCCACTCAATTGCCAGGG + Intronic
1158499518 18:57987515-57987537 AAGTCTCCTGACACCTGCAAAGG - Intergenic
1160142742 18:76339828-76339850 AAGGCTCCACACACTAGCCCAGG + Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1162091759 19:8284951-8284973 AGGTGGCCACACTCCTGCCACGG - Intronic
1162093996 19:8299800-8299822 AGGTGGCCACACTCCTGCCACGG - Intronic
1166383886 19:42369854-42369876 AAGTCTCCACACATCTCCCTGGG - Intronic
1167473913 19:49689545-49689567 GAGTCTCCACAGACCTCCTAGGG + Exonic
1167624625 19:50579368-50579390 CATTCTCCACACAGCAGCCAGGG + Intergenic
925828561 2:7874407-7874429 TAATCTCCACACACCAGCAAAGG - Intergenic
928857441 2:35817090-35817112 TAGTCGCCACACACCAGCAAAGG + Intergenic
930875178 2:56207243-56207265 GAGGCTCCACAGACCTTCCAGGG - Intronic
932288703 2:70557160-70557182 GAGTCTCCACACAGCTTCAAGGG - Intergenic
933524160 2:83415404-83415426 GAGACTCCACACCTCTGCCATGG + Intergenic
935801439 2:106700807-106700829 AAATCTCCTCAGAACTGCCAAGG + Intergenic
940043079 2:149380578-149380600 CAGTCTCCAAACATCTGCTATGG - Intronic
941244121 2:163075487-163075509 AAATCTGCACAGACCTTCCAAGG - Intergenic
941663270 2:168217028-168217050 AAGACTGCTCAGACCTGCCAGGG + Intronic
944695619 2:202197819-202197841 AAGTCACCACACTCCAGCCTGGG + Intronic
944731258 2:202520107-202520129 AAGTCTCCACACAAGTGACTGGG + Exonic
944875848 2:203963625-203963647 TAATCTCCACACACCAGCAAAGG - Intergenic
945790145 2:214294252-214294274 AGGGCTCCACATTCCTGCCATGG - Intronic
946854200 2:223936642-223936664 AAGGTCCCAGACACCTGCCAAGG - Intronic
947442870 2:230138553-230138575 AATTATCCACACACATGCAAAGG - Intergenic
947839508 2:233198527-233198549 AAGACTCCACATACATGTCAGGG - Intronic
947892508 2:233637221-233637243 AATTCTCCAAACCCCTGTCACGG + Exonic
947893763 2:233648870-233648892 AATTCTCCAAACACCTGTCATGG + Intronic
947895998 2:233672633-233672655 AATTCTCCAAACACCTGTTACGG + Exonic
947896879 2:233682636-233682658 AATTCTCCAAACCCCTGTCACGG + Exonic
947997100 2:234537238-234537260 AAGTCCCTACACCCCTGGCATGG - Intergenic
948794726 2:240396474-240396496 CAGTCTCCACACACCTGAACAGG - Intergenic
1169590988 20:7142042-7142064 AAGTTTGCAAACACCTGTCAAGG - Intergenic
1170032459 20:11957275-11957297 AAGTCTCCAGACTGATGCCAAGG - Intergenic
1171389704 20:24793426-24793448 AAGTGCCCAGACACCAGCCAAGG - Intergenic
1173502519 20:43564394-43564416 AAGTCCCCAGACATCAGCCATGG - Intronic
1173537548 20:43827675-43827697 AAGTACCCAGACACCAGCCAAGG - Intergenic
1173986776 20:47267614-47267636 CACTCTCCACACAGCAGCCAGGG + Intronic
1174001628 20:47379085-47379107 TAGTCTCCCTACATCTGCCATGG - Intergenic
1175156814 20:56976847-56976869 CAGTGTCCACACACCTGTCATGG - Intergenic
1176265377 20:64206489-64206511 AGGTCTCTACAGATCTGCCAGGG - Intronic
1176993965 21:15532223-15532245 AAGTTTTCAGACACCAGCCAAGG + Intergenic
1178469651 21:32880920-32880942 AAGACTTCAGATACCTGCCACGG + Intergenic
1179593717 21:42428309-42428331 AAGGCTGCAAAGACCTGCCAAGG - Intronic
1180099513 21:45577978-45578000 AACCCTCCACCCACCTGCCACGG - Intergenic
1181468370 22:23122910-23122932 ATGTCTTCACCCACCTCCCACGG - Intronic
1181746058 22:24955653-24955675 CAGCCTCCCCACACCAGCCAGGG - Intronic
1182607609 22:31518662-31518684 AAGTTTCCAGACACCAGCCAAGG - Intronic
1183047800 22:35234134-35234156 AAGTTCCCAGACACCAGCCAAGG + Intergenic
1185330058 22:50248471-50248493 ATGTCTCCACCCTCCTCCCAGGG - Exonic
949897325 3:8777988-8778010 AAGCCTCCACAGACCAGCCTGGG + Intronic
950699613 3:14731759-14731781 AAGTTCCCAGACACCAGCCAAGG + Intronic
952166326 3:30753370-30753392 AATTATGCACAAACCTGCCATGG - Intronic
952750566 3:36821684-36821706 AAATGTTCACACACATGCCAGGG + Intergenic
953034139 3:39197015-39197037 GAGTCTCCACCCTCCTGCCATGG + Intergenic
955411183 3:58656567-58656589 AAGTCTCCACAGACCTTCTGGGG - Intronic
955502411 3:59598266-59598288 AAGTCCTCACCCACCTTCCACGG - Intergenic
956151778 3:66251241-66251263 TTATCTCCACACAGCTGCCAGGG - Intronic
959169598 3:102829039-102829061 AAGTCCCCAGACATCAGCCAAGG + Intergenic
959550413 3:107649663-107649685 ATATGTCCACACACCTGCCAAGG + Intronic
959897019 3:111617028-111617050 AAGTGTGCACACACCTGGCCAGG - Intronic
961461491 3:127052976-127052998 CACTCTCCCCACACCTGCCTGGG + Intergenic
961502141 3:127343892-127343914 AAGTGGCCACACACAAGCCAAGG - Intergenic
961571773 3:127804433-127804455 AGGACTCCCCACTCCTGCCATGG + Intronic
961681569 3:128603531-128603553 GAGACTCCAAGCACCTGCCAAGG + Intergenic
961752432 3:129104772-129104794 GAGTCTCCACACTCATGACAAGG + Intronic
963930878 3:151003194-151003216 AAGTTTCCAGATACCAGCCAAGG - Intergenic
964962665 3:162447299-162447321 AATTCTCCACACAGCAGTCAAGG - Intergenic
968643227 4:1725542-1725564 AAGTCGCCTCCCAGCTGCCATGG + Intronic
969208543 4:5667941-5667963 AAGTTTCCAGACACCAGCCCAGG + Intronic
969664766 4:8550901-8550923 ATGTCTCTAGACACCTGCAATGG - Intergenic
972641761 4:40931830-40931852 AAGTCTCCTCACATCTTCTATGG + Intronic
974697877 4:65398255-65398277 AAGTGTGCACACATCTGCCTGGG - Intronic
975296282 4:72738220-72738242 AACTCTGCACAGAGCTGCCAAGG + Intergenic
976302133 4:83525295-83525317 ATGTCACCACACACCAGCCTGGG - Intergenic
977133582 4:93272712-93272734 CAGTCTTCTCACTCCTGCCATGG - Intronic
978727848 4:111991191-111991213 TAATCTCAACACATCTGCCACGG + Intergenic
979812887 4:125062278-125062300 AACTCGCCACCCATCTGCCAAGG + Intergenic
980282207 4:130736760-130736782 AAGTGTTTACACACCTGGCAGGG - Intergenic
981486653 4:145294057-145294079 AAGCTTCCACACACCTGCCAGGG + Intergenic
981503288 4:145475044-145475066 AAGTTTGCACAGACCTGTCATGG - Intergenic
981755923 4:148141879-148141901 AATTTTCCACAGACCTGGCAGGG - Intronic
982558219 4:156896369-156896391 AAGATACCACACACCTGTCAGGG - Intronic
983452602 4:167926895-167926917 TAATCTCCACACACCAGCAAAGG + Intergenic
984896141 4:184541739-184541761 TCGTCTCCACACAAATGCCACGG + Intergenic
985085940 4:186312469-186312491 TACTCTCCACTCCCCTGCCACGG + Intergenic
987108600 5:14664487-14664509 CAGTCCCCACACAGCTGACAAGG + Intergenic
988280344 5:29137619-29137641 AAGTTTCTAGACACCAGCCAAGG + Intergenic
990349885 5:54905310-54905332 AAGTCAGCACACACCTGGCTTGG - Intergenic
992480611 5:77148217-77148239 AATACTCCACACAGCAGCCAGGG - Intergenic
996303523 5:122018237-122018259 AATTTTCCACACAACAGCCACGG - Intronic
997721831 5:136084226-136084248 CAGTCTCACCACTCCTGCCAAGG - Intergenic
997741790 5:136261452-136261474 AAGTGTTCACACTCCTGCTAAGG + Intronic
998619757 5:143781062-143781084 AAGTATCACCTCACCTGCCAGGG + Intergenic
999282722 5:150375664-150375686 ATGTCTGCACACACCTACCCTGG + Intronic
999739975 5:154542508-154542530 AAGAGCCCACACAGCTGCCAAGG - Intergenic
1000011737 5:157239588-157239610 AAGTTCCCAAACACCAGCCAAGG + Intronic
1000212382 5:159119401-159119423 GAGCCTCCCCCCACCTGCCATGG + Intergenic
1000733005 5:164859754-164859776 ATGTGTCCACACACTTGGCATGG - Intergenic
1000939405 5:167342260-167342282 AAGACTCCTCAAAACTGCCATGG - Intronic
1001249466 5:170135665-170135687 AAGTCTACCCACTCCTTCCAAGG - Intergenic
1002068152 5:176662774-176662796 ATCTCTCCACATAGCTGCCAAGG - Intergenic
1002254536 5:177949597-177949619 AAGCGTCCACTCACGTGCCATGG + Intergenic
1002293511 5:178215235-178215257 CAGTCACCACCCACCTGCCAAGG - Intronic
1002483454 5:179518215-179518237 AAGCGTCCACTCACGTGCCATGG - Intergenic
1002572911 5:180154174-180154196 GAGGCTCCAGACACCTGCCCAGG - Intronic
1003378643 6:5602692-5602714 ATGTCTCCATGCACCTTCCAAGG - Intronic
1004189381 6:13450852-13450874 AAGTTGCCAGACACCAGCCAAGG + Intronic
1008547976 6:52600096-52600118 GAGTCTCCCAACACCTGCAAAGG - Intergenic
1011731377 6:90267405-90267427 AAGACTCCTAACACCTGGCAGGG + Intronic
1012075029 6:94672550-94672572 CAGTCTCCTCCCACCAGCCATGG - Intergenic
1014396335 6:120929174-120929196 TAATCTCCACACACCAGCAAAGG + Intergenic
1015359035 6:132314979-132315001 AAGTTTCCAGGCACCTGCCAAGG - Intronic
1016804094 6:148195631-148195653 AAGCCACCACCCACCTGCCAGGG - Intergenic
1017788373 6:157774577-157774599 AGGTCTCTGCACACCTGCCGGGG + Intronic
1018116065 6:160586488-160586510 AACTCTCCTCACAACTCCCACGG - Exonic
1019087290 6:169490524-169490546 AAGGACCCACAAACCTGCCAAGG + Intronic
1019582256 7:1770638-1770660 ACCTGTCCACAAACCTGCCAGGG - Intergenic
1019777709 7:2922386-2922408 ACGTCTGCACTCACCTGCCCAGG - Intronic
1021231723 7:18093207-18093229 AAGTCTCCACACACCTGCCAGGG - Intronic
1023171245 7:37391952-37391974 TAATCTCCACACACATGCAATGG + Intronic
1024532149 7:50402088-50402110 GAATCTCCACACACCTTCCTCGG - Exonic
1027376779 7:77558639-77558661 AAGTTCCCAGACACCAGCCAAGG - Intronic
1028570526 7:92281402-92281424 AAGTTCCCAGACACCAGCCATGG + Intronic
1030608864 7:111667466-111667488 AATTATCAACACACCTACCAAGG - Intergenic
1030748318 7:113196772-113196794 ATGTTTCCACACACCAGTCAGGG - Intergenic
1031951827 7:127900746-127900768 ATATATCCACACACATGCCAAGG - Intronic
1033846202 7:145434779-145434801 AAGTCACCACACATTTGTCAAGG + Intergenic
1034140752 7:148813501-148813523 AAGTCTATAAAAACCTGCCATGG + Intronic
1036009583 8:4707079-4707101 CATTTTCCACACAGCTGCCAGGG - Intronic
1036627695 8:10485055-10485077 ATGCCTGCACACAGCTGCCATGG - Intergenic
1038404277 8:27310376-27310398 AAGACTCCACACCCCTGGCCAGG + Intronic
1041898848 8:62958407-62958429 AAGTCTCACCATAACTGCCATGG + Intronic
1044222533 8:89686169-89686191 CAGTCTCCACATGGCTGCCAGGG - Intergenic
1045695637 8:104806017-104806039 ATGTCTCCACACTCCAGCCTGGG - Intronic
1047096195 8:121628689-121628711 AGGTCTCCACATTCCTGCCAGGG - Intronic
1047959765 8:130002668-130002690 AAGTCTCCTCACAGCCTCCATGG + Intronic
1048037869 8:130694032-130694054 AGGGCACCACACTCCTGCCATGG - Intergenic
1048853373 8:138665211-138665233 AAATCTACACAGACCTGCCCTGG + Intronic
1049133871 8:140875797-140875819 TAGTCTCCCTACACCTGCCTTGG - Intronic
1049486503 8:142866505-142866527 AGGTGTCCACACCTCTGCCATGG - Intronic
1049564025 8:143328528-143328550 AACTGTCCACACGCCTGCCGCGG - Intronic
1049591631 8:143465419-143465441 CAGTCACCACACCCCTACCATGG + Intronic
1049912386 9:281804-281826 GGGTCTCCACCCACTTGCCAAGG + Intronic
1053468903 9:38331406-38331428 AAGTTCCCAGACACCAGCCAAGG + Intergenic
1053511351 9:38690595-38690617 CATTCTCCACACTGCTGCCAGGG + Intergenic
1055020234 9:71661734-71661756 AACTCTCAGCACACATGCCATGG + Intergenic
1055582027 9:77715861-77715883 AAGAATCCACACATCTGCCCTGG - Intergenic
1056463592 9:86831984-86832006 AACCATCCACACACCTGCCCAGG - Intergenic
1056566444 9:87776932-87776954 AAGACACCACACCCCTCCCAAGG + Intergenic
1056815987 9:89801373-89801395 AAATCTCCACTCACCTGCCAAGG + Intergenic
1057935758 9:99237461-99237483 AAGTTTTCAGACACCAGCCAAGG - Intergenic
1058044484 9:100341693-100341715 AATTCCCCACACAGCAGCCAGGG + Intronic
1058294150 9:103284416-103284438 TAGATTCCAAACACCTGCCATGG - Intergenic
1059071511 9:111142227-111142249 AAGTTTCCAGACACCAGTCAAGG + Intergenic
1059468714 9:114487261-114487283 AAGTCTCAACCCACCACCCATGG + Intronic
1060176090 9:121498719-121498741 AAGCCTCAAAACACCTGCCTCGG + Intergenic
1060321199 9:122562546-122562568 GAGTCCCCACCCACCAGCCAAGG - Intergenic
1061325785 9:129863320-129863342 CAGTCCCCACACACCGCCCAAGG - Intronic
1062122853 9:134843021-134843043 AAGTCTCCCCACCCCCGCCCTGG + Exonic
1062560612 9:137139995-137140017 ACGTCTACACACACCAGTCAGGG - Intronic
1187620100 X:21043220-21043242 AAGTTCCCAGACACATGCCATGG + Intergenic
1189466503 X:41281610-41281632 AAGTTCCCAGACACCAGCCAAGG + Intergenic
1190059998 X:47204662-47204684 AAGTTCCCAGACACCAGCCAAGG + Intronic
1190098146 X:47499300-47499322 AAGTTCCCAGACACCAGCCAAGG - Intergenic
1190847652 X:54209107-54209129 AAGTTCCCACATACCAGCCAAGG + Intronic
1192197541 X:69038530-69038552 CTGCCTCCACACAGCTGCCAAGG + Intergenic
1194891536 X:99384977-99384999 AAGTGTGCACACACCTGGCCAGG + Intergenic
1194976540 X:100402411-100402433 AATTCTCCCCACCCCTGCCAGGG + Intronic
1197070670 X:122294319-122294341 AGGTATACACACACGTGCCATGG + Intergenic
1198470772 X:136944599-136944621 AAGTCTCCACATCCCTGACCAGG + Intergenic
1198640816 X:138754600-138754622 AAGTTCCCAGACACCAGCCAAGG - Intronic
1198642002 X:138766668-138766690 CAGTATTCACACACCTGCTAGGG - Intronic
1198749506 X:139924526-139924548 AAGTCCCCAGACACCAGCCAAGG - Intronic
1200291640 X:154881129-154881151 TATTCTCCACACAGCTTCCAGGG + Intronic
1200338475 X:155376820-155376842 TATTCTCCACACAGCTTCCAGGG + Intergenic
1200347994 X:155463872-155463894 TATTCTCCACACAGCTTCCAGGG - Intergenic