ID: 1021232292

View in Genome Browser
Species Human (GRCh38)
Location 7:18100588-18100610
Sequence TCATCTCTTGAAGTTCAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 1, 2: 16, 3: 56, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021232289_1021232292 -2 Left 1021232289 7:18100567-18100589 CCATCTCACACATTGTAGTTTTC 0: 1
1: 1
2: 4
3: 29
4: 264
Right 1021232292 7:18100588-18100610 TCATCTCTTGAAGTTCAATGGGG 0: 1
1: 1
2: 16
3: 56
4: 309
1021232288_1021232292 24 Left 1021232288 7:18100541-18100563 CCAAGTAGTCATATTTAGTGTGT 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1021232292 7:18100588-18100610 TCATCTCTTGAAGTTCAATGGGG 0: 1
1: 1
2: 16
3: 56
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021232292 Original CRISPR TCATCTCTTGAAGTTCAATG GGG Intronic
900356167 1:2265433-2265455 TCATCTCTAGAAGTTTGATTTGG + Intronic
900536866 1:3182972-3182994 TCATTTCTAGAATTTCTATGGGG - Intronic
900921621 1:5675411-5675433 TCATCTCTAGAAGTTCAGGCTGG + Intergenic
901155490 1:7134886-7134908 TGATCTGTTGAAGTTCATTATGG - Intronic
902525178 1:17052816-17052838 TCCTCTCTTGCACTTAAATGAGG - Intronic
902617685 1:17632756-17632778 GAATCTCTTGAATTTCAATGTGG - Intronic
902931166 1:19732521-19732543 TCCTCTCTAGATGATCAATGAGG + Intronic
904338841 1:29819377-29819399 TCATCTCTTGAATTTTTATTTGG + Intergenic
904743638 1:32697346-32697368 GAATCTCTTGAACTTCAAAGAGG + Intronic
907152491 1:52301995-52302017 TCATCTCTTGAAGTTATACTTGG + Intronic
908033229 1:60023955-60023977 TTATCTCTAGAAGTTCTATTTGG + Intronic
908777779 1:67657948-67657970 TAATCTCTAGAAGTTCCATTTGG + Intergenic
909830856 1:80188064-80188086 TAATCTCTTGACCTTCAATTTGG + Intergenic
910164232 1:84307362-84307384 TCATCTCTAGCAGTTCAATGTGG + Intronic
910542454 1:88375887-88375909 ACATATCTTGAAGTCCAATGGGG + Intergenic
911438685 1:97897684-97897706 CCATCTTTAGAAGTTCAATTTGG + Intronic
911479836 1:98424259-98424281 TCTTCTCTTGAAGGTGAGTGAGG - Intergenic
911835642 1:102615286-102615308 TCATTTCTACAAGTTCAATTTGG - Intergenic
913040858 1:115021557-115021579 TAATCTCTAGAAGTTCCATTTGG + Intergenic
913106755 1:115621831-115621853 TCATCTCTAGAAGCTCAACTTGG + Intergenic
913716885 1:121544381-121544403 TCACCTCCTGAAGTTCTATTTGG - Intergenic
915695588 1:157738572-157738594 TCAGCTCTAGAAGTTCAGTTTGG + Intergenic
917022027 1:170600217-170600239 TCATCTTTAGAAGTTTAATTTGG + Intergenic
917412838 1:174777703-174777725 TTATCTCTTAAAGTTTAATTTGG - Intronic
917571673 1:176272256-176272278 TCATCTGTTGAAGTACACTTTGG + Intergenic
917886139 1:179386974-179386996 TCATCTCTAGAAGGTCAGTTTGG + Intronic
918009658 1:180574802-180574824 TCATCTCTTGAAATTGATTCAGG + Intergenic
918153770 1:181822991-181823013 TCATCTCTAGTAGCTCAATTTGG - Intergenic
918442406 1:184580931-184580953 TCCTCTCTTGAATTTAGATGTGG + Intronic
918510071 1:185302765-185302787 TCATCTCTTTTAGTCCAGTGAGG + Intronic
918549961 1:185731074-185731096 TCAACTCTTGACGTTTAATTTGG - Intergenic
919007310 1:191913508-191913530 TCATGTATTGAAGGTCACTGGGG + Intergenic
920707512 1:208265282-208265304 TCATTTCATGAAGGTCAAAGAGG + Intergenic
922253673 1:223872951-223872973 TCATCTCTTAGAATTCCATGAGG + Intergenic
923100705 1:230814207-230814229 TCATCTCTAGAAGTTCAATTTGG + Intergenic
924393614 1:243591729-243591751 TCATCTCTTGAAGTTTGATTTGG - Intronic
1064235832 10:13574224-13574246 TCATCTCTAGAGGTTCCATTTGG + Intergenic
1064738345 10:18406842-18406864 TTAGCTCTTGAAGTACAAAGAGG + Intronic
1064771413 10:18727512-18727534 GCATTTCTTAAAGTGCAATGTGG + Intergenic
1065163536 10:22949428-22949450 TCATCTCTAGAAGTTGTATTTGG - Intronic
1066405553 10:35114786-35114808 TCATTTCTGGAAGTTCTATTTGG - Intergenic
1066469388 10:35683479-35683501 TCATCTCTTCAAGTTCAAGTTGG - Intergenic
1067073042 10:43151023-43151045 TCATCTCCTGAAGTTTAACTTGG + Intronic
1068593021 10:58869691-58869713 TCACCTCTAGAATTTCAATAAGG + Intergenic
1068645624 10:59463602-59463624 TCACCTCTTGCATTTTAATGTGG - Intergenic
1069026311 10:63546056-63546078 TCATCACATGGAGGTCAATGTGG + Intronic
1069972071 10:72180306-72180328 TTATCTCTTGAAGTTCCATTTGG - Intronic
1070218042 10:74407361-74407383 TCATCTCTTGAACTTTGATTTGG + Intronic
1071161907 10:82756620-82756642 TCATCTGTATAAGTTCCATGAGG - Intronic
1072078383 10:92002086-92002108 TCATCTCTAGAAGTTCAATTTGG - Intronic
1072321625 10:94255807-94255829 ACATCTCTTAAACTTTAATGTGG - Intronic
1072345981 10:94506779-94506801 GCATCTGTTGAAGTGCTATGAGG + Intronic
1072602889 10:96947292-96947314 TCATCTTCTGGAGTTTAATGAGG - Intronic
1072848987 10:98866185-98866207 TCATCTCTAGAAATTCAATTTGG - Intronic
1072864551 10:99043672-99043694 TCAGCTCTAGAAGTTCAGTTTGG - Intronic
1073010498 10:100355539-100355561 ACATCTTTTGAACTGCAATGTGG + Intronic
1073739590 10:106391758-106391780 TCATCACTTGAAATTAAATAAGG + Intergenic
1074648949 10:115496911-115496933 GCATTTCCTGAAGTTGAATGTGG + Intronic
1074748846 10:116563729-116563751 TCATCTCTAGAAACTCAGTGTGG - Intronic
1075387601 10:122068154-122068176 TCATCTCTAGAAGTTTGATTTGG + Intronic
1075761037 10:124857011-124857033 TCATCTCTAGAACTTCCATGAGG + Intergenic
1077852169 11:6084088-6084110 TCAGCTCTAGAAGTTCAGTTTGG + Intergenic
1078072259 11:8123051-8123073 TCATCTCTAGAAGTTTCATTTGG - Intronic
1078574647 11:12489311-12489333 TCATTTCTAGAAGTTCTATTTGG - Intronic
1079785972 11:24673350-24673372 TGATTTCATGAAGTCCAATGTGG + Intronic
1079904800 11:26232118-26232140 TCCTCTATTGAAGGTCTATGTGG + Intergenic
1081447288 11:43143078-43143100 TCATTTCTAGAAATTCAATTTGG - Intergenic
1083206697 11:61154388-61154410 TCATCTCTAGAAGTTTGATTTGG - Intronic
1083230094 11:61311825-61311847 TCGTGTCTTGGACTTCAATGCGG + Exonic
1084548763 11:69828268-69828290 TCCTCTCTTGAAGTCAAGTGGGG - Intergenic
1085365434 11:75938185-75938207 TCATCTCTGAAAGTTCAATTTGG + Intronic
1086365763 11:86109091-86109113 TCATAACTTGGAGTTCACTGTGG - Intergenic
1088148280 11:106712333-106712355 TCCTCTATAGAAGTTCAATTTGG + Intronic
1088895695 11:114076720-114076742 TCTTTCCTTGAAGTTCAGTGTGG + Intronic
1091029855 11:132175862-132175884 GGAGCTCTGGAAGTTCAATGGGG - Intronic
1095257883 12:40061700-40061722 TCATCTTTTGATGTTCATGGGGG - Intronic
1095458400 12:42414835-42414857 TCATTTCTAGAAGTTCAATTTGG + Intronic
1095904156 12:47360351-47360373 TCATCTCAGGAAGTTCTATTGGG + Intergenic
1096644801 12:53026493-53026515 TAATTTCTTGAAATTCACTGAGG - Intronic
1098974994 12:76893226-76893248 TTATCTCTAGAAGTTCAATTTGG - Intergenic
1099054628 12:77823929-77823951 TCATCTCTAGGAGTTCCATTTGG - Intergenic
1099649011 12:85400387-85400409 TCATAACTTCAAGTACAATGTGG - Intergenic
1099769829 12:87037076-87037098 TCAAGTCTGGAAATTCAATGTGG - Intergenic
1103220207 12:119238068-119238090 TCATCTCTAGAAGTTCAATTGGG + Intergenic
1106366815 13:29089779-29089801 TCATTTCTGGAAGTTCAGTTTGG + Intronic
1106735446 13:32584454-32584476 TGATGCCTTGAATTTCAATGAGG - Intergenic
1107096166 13:36538903-36538925 TCATCTCTAGAAGTTCCATTTGG + Intergenic
1108438045 13:50420726-50420748 TCCTGTCTTTATGTTCAATGTGG - Intronic
1109990251 13:70045601-70045623 TCATCTTTAGAAGTCCAAAGAGG - Intronic
1110208004 13:72940336-72940358 TCATTTCTAGAAGTTCAAATTGG + Intronic
1110516956 13:76424974-76424996 TCATTTCTAGAAGTTGAATTTGG + Intergenic
1111157591 13:84348811-84348833 ACAACTCTTGAAGTTGATTGTGG + Intergenic
1115514228 14:34169110-34169132 TCATGTCTTGGAGTTGAAAGTGG - Intronic
1116060136 14:39912989-39913011 CCCTCTCTTGCAGTTCAATGGGG - Intergenic
1116399189 14:44484331-44484353 TCATCTGTTGATGTTCACTTAGG + Intergenic
1116572787 14:46538975-46538997 GCTTCTCTTGTAGTTCACTGTGG - Intergenic
1117001365 14:51374750-51374772 TCAGGTCTTGAAATTCACTGAGG - Intergenic
1117540927 14:56745914-56745936 TCATCTCCTTAAGTTCCATATGG + Intergenic
1118061784 14:62147113-62147135 TGATCTTTTGTATTTCAATGGGG - Intergenic
1118068821 14:62223051-62223073 TCATTTCCAGAAGTTCAGTGTGG + Intergenic
1118314545 14:64717627-64717649 TCATCTCTTGACGTTCATATTGG + Intronic
1119953788 14:78773302-78773324 TCATCTATTGATATTGAATGTGG + Intronic
1120928610 14:89823752-89823774 TCATCTCTAGAAGTTCCACTGGG - Intronic
1121740389 14:96247956-96247978 TCATATTCTGAAGTTCCATGTGG - Intronic
1121855051 14:97260559-97260581 TCATCTCTAGAAGTTCAGTTTGG - Intergenic
1122253306 14:100456568-100456590 TCATCTCTAGAAGTCCAGTTTGG - Intronic
1122260699 14:100519483-100519505 TCATCTCTTGAAGTGTGATTTGG + Intronic
1124008472 15:25813704-25813726 TCAACTCTAGAAGTTCAATTTGG - Intronic
1124480244 15:30073186-30073208 TCGTCTTTTGAAGTTTACTGCGG - Intergenic
1124898701 15:33801861-33801883 TTCTCTCTTGAAGTTCTAAGTGG - Exonic
1126149128 15:45506481-45506503 TAATCTCTTGAAGTTCTATGGGG - Intronic
1126659201 15:51015417-51015439 TCATCTCTAGAGGTTCCATTTGG + Intergenic
1127049225 15:55063396-55063418 TTATCTCTAGAAGTTCATTTTGG - Intergenic
1127198649 15:56619132-56619154 TCATCCCTGAAAGTTCAATTTGG + Intergenic
1127746871 15:61986337-61986359 TCAGTTCTTGAATTTCTATGTGG - Intronic
1128330713 15:66753711-66753733 TTTCCTCTTCAAGTTCAATGAGG - Intronic
1130139686 15:81214961-81214983 TCAGCTCTAGAAGTTCAGTTTGG + Intronic
1130700125 15:86170181-86170203 TCATCTCCAGAGGTTCAATTTGG - Intronic
1131693595 15:94853326-94853348 TCAGCTCTAGAAGTTCAGTGTGG + Intergenic
1135684623 16:24488718-24488740 TCATCTCTTGAAGTTTAATTTGG + Intergenic
1137496880 16:48976568-48976590 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1137544365 16:49390545-49390567 TCATCTCGAGAACTTCAATTTGG + Intronic
1139049455 16:63105761-63105783 TCATCTGTTGATGTACACTGGGG + Intergenic
1140528037 16:75640298-75640320 TCATCAGCTGAAGGTCAATGGGG - Exonic
1142732749 17:1872577-1872599 TCATGTTTTGAAGTTGAATCTGG + Intronic
1144133668 17:12271979-12272001 TCATTTCTTGAAGTTCTACTTGG - Intergenic
1146463965 17:33071409-33071431 TAATCTCTAGAAGTTCAACTTGG + Intronic
1149327097 17:55543130-55543152 TCATCTCTAGAAGATTAATTTGG + Intergenic
1149956111 17:61052356-61052378 TTATCTCTTGAAGTTCCATTTGG + Intronic
1150101648 17:62429256-62429278 TCATCTCATTAAATTCAGTGTGG + Intronic
1151981372 17:77511553-77511575 TCATCTCTAGAATTTCCATTTGG + Intergenic
1152522272 17:80863532-80863554 TCATCTCTAGAAATTCAAGTTGG - Intronic
1153015524 18:579631-579653 TGATCACTTGACATTCAATGTGG - Intergenic
1153083402 18:1255172-1255194 TCATATTTTGAAGTTGCATGGGG + Intergenic
1153770442 18:8411261-8411283 TCATCTCTTGAAGTTCAATTTGG - Intergenic
1155372914 18:25122130-25122152 TCATCTCTTCAAGTTCAATATGG - Intronic
1156052066 18:32949564-32949586 TTATTTCTAGAAGTTCAATTGGG + Intronic
1157564675 18:48671949-48671971 TTATCTCTCGAAGGTCATTGTGG + Intronic
1158807206 18:60988034-60988056 TCATGTCTTGAATTTCTATTAGG - Intergenic
1158906338 18:62016434-62016456 TCATATCTTTAATTTTAATGAGG + Intergenic
1160600402 18:80008279-80008301 TCTGCTCTTTAAGTTCTATGGGG + Intronic
1162784890 19:13028482-13028504 TCATCTCTTGAAGCTTCATCTGG - Intronic
1168568494 19:57444000-57444022 GAATCTCCTGATGTTCAATGGGG - Exonic
928822263 2:35375526-35375548 TCATCACTAGAAGTTCAATTTGG - Intergenic
928972540 2:37046335-37046357 CCATCTCTTGACTTTTAATGAGG - Intronic
929656550 2:43737970-43737992 TCATCTCTAAAAATTCAATTTGG - Intronic
929752976 2:44736828-44736850 TCATCTCTAGAAGTTTGATTTGG + Intronic
929990935 2:46785957-46785979 TCATCTCTTGAAATCCCATTTGG - Intergenic
930489352 2:52048435-52048457 TCAGCTCTTGAATTTCTATTAGG - Intergenic
930950495 2:57137657-57137679 TCATTTCTTGAAGTAAAATTAGG + Intergenic
934042752 2:88142792-88142814 TCATCTCTAAACATTCAATGTGG + Intergenic
934530489 2:95084314-95084336 TCATCTCTAGAGGTTCAACTTGG + Intergenic
935323629 2:101913511-101913533 TCATCTCTTGAAGAACATTTGGG + Intergenic
935839256 2:107091262-107091284 TCATCTCTTGAAGTTAGAGTTGG + Intergenic
937286473 2:120757049-120757071 TCATCTCTAGAAGTTTGATTGGG + Intronic
939682332 2:145153729-145153751 ACATCTGTGGAAGTTCTATGTGG + Intergenic
939945344 2:148403081-148403103 TTATCTCTAGAAGTTCAATTTGG + Intronic
941329915 2:164167436-164167458 TCATCTCTAGAAGTTAAAGTTGG + Intergenic
942384362 2:175425662-175425684 TCATCTCTGGAAGTTCAGTTTGG - Intergenic
942433326 2:175940826-175940848 TTATCTGTAGAAGTTCAATTTGG - Intronic
943261523 2:185669755-185669777 TCAACTCTTGCAATTCTATGAGG + Intergenic
943424206 2:187709121-187709143 GCATCTCAGTAAGTTCAATGTGG + Intergenic
943444194 2:187963051-187963073 TTATATCTTCAAATTCAATGTGG - Intergenic
943622513 2:190165474-190165496 TCATTTCTTGAAATTCTATTTGG - Intronic
944291789 2:198016391-198016413 TCCTCTCTTCAAGTCCCATGTGG + Intronic
945602454 2:211885149-211885171 ACATCTCTTCAATTTCAATATGG + Intronic
945723338 2:213446394-213446416 TCATTTCCTGAAGTTCAGTTTGG - Intronic
946262153 2:218502287-218502309 TCATCTCTAGAAGTTTAATTTGG - Intronic
946302223 2:218830896-218830918 TCATCTCTGGAAGGGGAATGGGG + Exonic
947320824 2:228916485-228916507 TCAAGTCTTGAAGTTTACTGGGG - Intronic
947354523 2:229278037-229278059 TCATCTCCTGCAGCTAAATGAGG + Intergenic
947675399 2:231974515-231974537 TTATCTCTAGAAGTTTAATTTGG + Intronic
947947052 2:234113871-234113893 TCGTCTCTAGAAGTTCTATTCGG + Intergenic
1168812536 20:714693-714715 TCATTTCTAGAAGTTCAGTTTGG + Intergenic
1168920443 20:1530439-1530461 TCATCTCTAAAAGTTCAATATGG + Intergenic
1169159418 20:3363948-3363970 TCATCTCTAGAAGTTGATTTGGG + Intronic
1169188437 20:3640175-3640197 TCATTTCTAGAAGTTCCATTTGG - Intronic
1169296644 20:4405683-4405705 TCTTCTCTTAAAGATCTATGAGG + Intergenic
1169918155 20:10704392-10704414 CCATCTCTTGAAGTTCATAGTGG + Intergenic
1170013836 20:11757982-11758004 TCATGTCTGCAAGATCAATGTGG + Intergenic
1171773007 20:29340904-29340926 TCATCTCTAGAAGTTCAAGCTGG - Intergenic
1171815102 20:29779145-29779167 TCATCTCTAGAAGTTCAAGCTGG - Intergenic
1171903337 20:30877577-30877599 TCATCTCTAGAAATTCAAGCTGG + Intergenic
1172868260 20:38117239-38117261 TCATTTCTAGAAGTTCTATTTGG + Intronic
1174185942 20:48706450-48706472 TTTGCTCTTGAAGTTCAAAGTGG + Intronic
1175380743 20:58561229-58561251 TCATCTCTAGAAATTCCATTTGG - Intergenic
1175454303 20:59099119-59099141 TCATCTATAGAACTTCATTGAGG + Intergenic
1176372053 21:6068149-6068171 TCCTCTCTTGGAGTTCTAGGCGG + Intergenic
1177213452 21:18098822-18098844 TCATCTCTTGATGGACAATAAGG - Intronic
1178966009 21:37118877-37118899 TCATCTCTAGAGGTTAAATTTGG + Intronic
1179751466 21:43470390-43470412 TCCTCTCTTGGAGTTCTAGGCGG - Intergenic
1179837647 21:44047758-44047780 TCATCTCTAAAAGTTCCATATGG + Intronic
1180318538 22:11299698-11299720 TCATCTCTAGAAGTTCAAGCTGG - Intergenic
1183274191 22:36881591-36881613 TCAACTCTAGAATTTCAATTTGG - Intergenic
1184836246 22:47023191-47023213 TCCTCTCTGTAAGTTCAATGTGG - Intronic
1184896719 22:47411847-47411869 TCATCTCTAGATGTTCAATTTGG - Intergenic
1185206851 22:49544372-49544394 ACAACTCTTGAAGCTAAATGGGG - Intronic
951905810 3:27706271-27706293 TTATCTCTAGAAGTTCAATTTGG + Intergenic
952745197 3:36770397-36770419 TCTTTTCTTGAATTTCAATCTGG - Intergenic
953436190 3:42879811-42879833 TCATCCATTCAAGTTCAATCAGG - Intronic
955168682 3:56541359-56541381 TCATCTTTAGAAGTTCAATTTGG + Intergenic
956325563 3:68048855-68048877 TCATCTGTTGATGTACACTGAGG + Intronic
956540245 3:70328484-70328506 TCATCTCTACAAGTTCAAATTGG - Intergenic
956546140 3:70405515-70405537 TCATCTCTAGAAGTTCCATTTGG - Intergenic
957027134 3:75194675-75194697 TCATTTCTAGAAGTTCATTTTGG - Intergenic
958052257 3:88363374-88363396 TCATCTCTGGAAGTTAGATTTGG + Intergenic
958570900 3:95881909-95881931 TTATCTCTTGAAGTTAAGGGAGG + Intergenic
960260499 3:115562806-115562828 GCTTCTCTTGCAGTTCGATGTGG - Intergenic
960579383 3:119261973-119261995 TCATCTCTACAAGTTCAATTTGG - Intergenic
961084666 3:124056538-124056560 TAATCTCTTGAAAGTCTATGGGG + Intergenic
961983111 3:131103003-131103025 TCAGCTCTAGAAGCTCAATTTGG + Intronic
962093779 3:132272470-132272492 GCATCTATTGAACTTGAATGAGG - Intronic
962379378 3:134885130-134885152 TCATCTCTAGATGTTCTATTTGG - Intronic
962816033 3:139001381-139001403 TTATCTCTAGAAGTTCCATTAGG + Intergenic
963149272 3:142027616-142027638 TCATTCTTTGAAGTTCAATAAGG - Intronic
963219674 3:142795032-142795054 TCATCTCTGAAAGTTTAATTTGG - Intronic
963621724 3:147616528-147616550 TAATTTCTTGAGGTTGAATGGGG - Intergenic
964975290 3:162611759-162611781 AAATCTTTTGAAGTTAAATGAGG + Intergenic
965221310 3:165930636-165930658 ACATCTCTTGAAAGTCAGTGGGG + Intergenic
967305649 3:188056557-188056579 TCTTCTCTGGAAGTTCAGGGAGG - Intergenic
967810129 3:193752427-193752449 CCATCTTTTGAAGTTCAATTTGG + Intergenic
968217232 3:196903463-196903485 TCCTCTTTTGAAGTTAAATCTGG + Intronic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
970542376 4:17092945-17092967 TCATCTCTAAAAATTTAATGAGG + Intergenic
971479781 4:27104151-27104173 TCATCTCTTCCAGATCAATCTGG - Intergenic
971511512 4:27432077-27432099 TCATCTGTTGATGGTCAATTAGG - Intergenic
972114360 4:35610648-35610670 TCTCCCCTTGAAGTTCTATGGGG - Intergenic
973235113 4:47893036-47893058 TCATCTCTAGAAGTTGGATTTGG - Intronic
973560648 4:52131769-52131791 ACCTCTCTTGAAGTTAAGTGTGG + Intergenic
975031561 4:69625581-69625603 TCATCTCTGGTAGTTTAATGTGG + Intronic
975566927 4:75766964-75766986 TCATTTCTTGAAGTTCAGAGGGG + Intronic
975600394 4:76093795-76093817 TTATCTCTAGAAATTCAATTTGG + Intronic
975922523 4:79409075-79409097 TCATCCCTAGAAGCTCAATTTGG + Intergenic
976222277 4:82766413-82766435 CCATCTCTAGAAGTTTAATTTGG + Intronic
977195429 4:94053165-94053187 TCATTTCTAGAAGTTCAGTTTGG - Intergenic
977958725 4:103060357-103060379 TCATTTCTAGAAGTTCAAGTTGG + Intronic
977997594 4:103514171-103514193 TCATCTCTAGAAGGTCAGTTTGG + Intergenic
978308221 4:107355507-107355529 TTATATCTAGAAGTTCAATTTGG + Intergenic
978343834 4:107744964-107744986 TTATCTCTAGAAGTTCAACTTGG + Intergenic
978535745 4:109760411-109760433 TCATTCCTTAAAGTTGAATGAGG + Intronic
978538486 4:109789037-109789059 TTATCCCTAGAAGTTCAATTTGG - Intronic
978547424 4:109886597-109886619 TCATCTCTTGGAGTTCAAATAGG + Intergenic
978588201 4:110295245-110295267 ACATCTCTTCAATTTCCATGTGG + Intergenic
979199169 4:117956307-117956329 GCATCTCTTGAAGTGAAAAGTGG - Intergenic
980540773 4:134191093-134191115 TCATCTCTTGAAATGTATTGTGG + Intergenic
980560390 4:134465288-134465310 TTATCTCTAGAAGTTCCATTTGG - Intergenic
980831326 4:138132607-138132629 TCATCTCTAGAATTTCTATCTGG + Intergenic
983110842 4:163747637-163747659 TTAGCTCTAGAAGTTCAATTTGG - Intronic
983199910 4:164850216-164850238 TCACCTCTTGAATTACTATGGGG - Intergenic
983336012 4:166393472-166393494 TCATCTCTAGAAGTGTAATTTGG + Intergenic
984183815 4:176517731-176517753 TCATGGCCTGAAGTTCATTGTGG - Intergenic
986226877 5:5823844-5823866 TCATCTCTAGAGCTGCAATGGGG + Intergenic
986816822 5:11421551-11421573 TCATCACTTGGAGTACACTGTGG + Intronic
986859262 5:11906141-11906163 ACATCTCTTGAAATATAATGTGG - Intergenic
987649154 5:20718450-20718472 TGAGCTCTAGAAGTTCAGTGTGG + Intergenic
988404801 5:30810516-30810538 TCATGTGTTGGGGTTCAATGTGG + Intergenic
988606094 5:32679628-32679650 TTATCTCTTCAATTTCAGTGGGG - Intergenic
988746404 5:34143089-34143111 TGAGCTCTAGAAGTTCAGTGTGG - Intergenic
989377712 5:40782236-40782258 TCATTTCTTAAAGTTAATTGGGG - Intronic
989961676 5:50423388-50423410 TCACCTCCTGAAGTTCTATTTGG + Intronic
990410926 5:55540298-55540320 TTATCTCATGAAGTTGAATGTGG - Intergenic
991260680 5:64664389-64664411 TCATCTCTAGAGGTTCAAAAGGG - Intergenic
992011258 5:72529836-72529858 TCCTCTTTTGAAGTTGAATATGG - Intergenic
992029423 5:72706756-72706778 TAATCTCTAGAAGTTCAATTTGG + Intergenic
993150053 5:84149775-84149797 TCATCTCTGGAAGTTCAATTAGG - Intronic
993215353 5:85015892-85015914 TCATCTTTTGAAGTTATGTGTGG + Intergenic
993366810 5:87043719-87043741 TCATCTCTAGAAGTTCTATTTGG + Intergenic
993428939 5:87806240-87806262 TTATCTCTACAAGTTCAATTTGG - Intergenic
994060820 5:95474944-95474966 TCAGCTCTGGAAGTTCAGTTTGG + Intronic
994443658 5:99843597-99843619 TCATATCTAGAAGTTTAATGGGG + Intergenic
995208948 5:109515151-109515173 TCAGATCTTGAAGTTGCATGGGG + Intergenic
995566184 5:113434725-113434747 TGAGCGCCTGAAGTTCAATGTGG - Exonic
995978092 5:118066751-118066773 TCAGCTCTAGAAGTTCAATATGG + Intergenic
996253869 5:121374029-121374051 TCTTTTCTGGAAGTTCAATTTGG - Intergenic
996776646 5:127139913-127139935 TCATCTCTGGAGGTTCAATTTGG + Intergenic
996898040 5:128509411-128509433 TCATCTGTAGAAGTTCAATTTGG + Intronic
1001150097 5:169219747-169219769 TCATCTTTTGAATTTCCATGTGG - Intronic
1001843097 5:174896983-174897005 TCATCTTTAGAATTTCAATTTGG + Intergenic
1004973917 6:20943610-20943632 TCATCTCTAGAAGTTCCACTAGG + Intronic
1006867809 6:37222942-37222964 TCATCTCTAGAAATTCTATTTGG - Intronic
1007065129 6:38982712-38982734 CCTTCTCTTGAAGTGCACTGTGG - Intronic
1007528353 6:42517062-42517084 TCATCTCTAGGGGTTCAATTTGG - Intergenic
1007561506 6:42812584-42812606 TCATCTCCAGAAGTTCAATTTGG - Intronic
1008725728 6:54416230-54416252 TCATCTCCAGAAGTTCCATTTGG - Intergenic
1011578871 6:88835170-88835192 TAATCTCTTGAAGTTCCTAGTGG - Intronic
1012365749 6:98437510-98437532 TCATCTGTTGATGTACAATTAGG - Intergenic
1012890612 6:104893020-104893042 TCATCTCTAGAAATTCTATTTGG + Intergenic
1013641894 6:112091896-112091918 TCATCTCTAGAAGTCTAATTGGG - Intronic
1013642808 6:112103436-112103458 TCATCTCTAAAAGTTCTATTTGG - Intergenic
1016576463 6:145574139-145574161 TCAACTCTTGAAATTGATTGAGG + Intronic
1018069572 6:160151572-160151594 TTATCTCTAGAAGTTTAATTTGG - Intronic
1019654315 7:2181108-2181130 TCATCTGTAGAATTTCTATGTGG + Intronic
1020727996 7:11841384-11841406 TATTCTCTTGAATTTCACTGAGG + Intergenic
1021232292 7:18100588-18100610 TCATCTCTTGAAGTTCAATGGGG + Intronic
1022555202 7:31287280-31287302 TCATCTCTAAAAGTTCTATTTGG + Intergenic
1022588562 7:31639413-31639435 TCATCTCTAGACATTCAATTTGG + Intronic
1023785552 7:43704649-43704671 TCATTTCTGGAAGTTCAGTTTGG + Intronic
1024310085 7:47961181-47961203 TCATCTCTTGATGGTCACTTAGG - Intronic
1026063924 7:67052481-67052503 TCATTTCTAGAAGTTCAGTTTGG + Intronic
1026714429 7:72774978-72775000 TCATTTCTAGAAGTTCAGTTTGG - Intronic
1027026448 7:74855403-74855425 TTATCTATAGAAGTTCAATTTGG - Intergenic
1027061307 7:75088711-75088733 TTATCTATAGAAGTTCAATTTGG + Intergenic
1028785777 7:94791689-94791711 TCATTTCTAGAAGTTCACTCTGG + Intergenic
1028938929 7:96497960-96497982 TCATCTCTAAAAGTTCTATTTGG - Intronic
1028965944 7:96801317-96801339 ACAACTCCTGAAGTTCATTGAGG - Intergenic
1029825048 7:103183092-103183114 TCAGCTCTAGAATTTCCATGGGG + Intergenic
1029999663 7:105045687-105045709 TCATCTCTTGACGTACACTTGGG + Intronic
1030102747 7:105960828-105960850 TCATCTTTTGGAATTCATTGTGG - Intronic
1030129590 7:106187135-106187157 TCATCTCTGGAAGTTCAATTTGG + Intergenic
1030172190 7:106614512-106614534 TCATCTCTAGAAGTTTATTTTGG + Intergenic
1030625115 7:111836695-111836717 TCATCTCTAGAAGTTTAATTTGG - Intronic
1031013436 7:116547574-116547596 TCATCTCTAGCAAGTCAATGAGG - Intronic
1031256690 7:119460562-119460584 TGACCTCTAGAAGTTGAATGTGG - Intergenic
1032886841 7:136149696-136149718 TCATCTCTAGAAGTTTCATTTGG + Intergenic
1033303095 7:140203551-140203573 TCATCTCTGAAAATTCAATTTGG + Intergenic
1033831654 7:145261947-145261969 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1035206598 7:157297658-157297680 TAATCTCTTGATGTTAAACGTGG - Intergenic
1035922454 8:3692294-3692316 TCATAACTTGAAGTTCAGTGGGG - Intronic
1037085610 8:14845651-14845673 TCATCTCTGAAAGTTCAATTTGG - Intronic
1037448890 8:18997044-18997066 TCATCTCTTCAATCTCAGTGTGG + Intronic
1037731548 8:21529003-21529025 TTATCTCTAGAACTTCAATTTGG + Intergenic
1038770037 8:30469582-30469604 TCATCTCTTGAACTTCTATGAGG + Intronic
1038990374 8:32860700-32860722 TCATTTCCAAAAGTTCAATGTGG - Intergenic
1039678152 8:39695123-39695145 TCATCTATTAAAGGACAATGTGG + Intronic
1039929554 8:41972314-41972336 TCATCTCTGGATGCTAAATGTGG + Intronic
1040931720 8:52742209-52742231 TAATCTCTAGAAGTTTAATTTGG - Intronic
1041390111 8:57340225-57340247 TTCTCTCTTGAAGACCAATGTGG - Intergenic
1041504064 8:58574661-58574683 TCTTCTCTTGATGTTCCATCTGG + Intronic
1041930923 8:63285370-63285392 TCATCTGTTGATGGTCATTGAGG + Intergenic
1042487176 8:69359518-69359540 TCTTCTCTTTAATTTCCATGGGG + Intergenic
1043585303 8:81761542-81761564 TCATCTCCAGAACTTCAATTTGG - Intergenic
1043594226 8:81865038-81865060 TCAGCTCTAGAAGTTCAGTTTGG - Intergenic
1044185987 8:89252970-89252992 TCAGCTCTAGAAGTTCAATTTGG + Intergenic
1044226303 8:89722825-89722847 TCCTCTCTTGAAATTCAGAGTGG + Intergenic
1044394671 8:91696764-91696786 TCATCTCTTGATGGACAATTAGG + Intergenic
1045053263 8:98345821-98345843 TCATCTCTAGAAATTCAATTTGG - Intergenic
1045171937 8:99680701-99680723 CCATTTATTAAAGTTCAATGAGG + Intronic
1045464445 8:102456726-102456748 GCTTCTCTTCAAGTTCAATAAGG - Intergenic
1045774608 8:105788058-105788080 TCATTTCAGGAAGTTCAATCAGG + Intronic
1046095332 8:109552314-109552336 TCATCTCTGGATGATCACTGGGG + Intronic
1046276196 8:111963938-111963960 TCAGCTCTAGAAGTTCAGTTTGG + Intergenic
1046366947 8:113246394-113246416 TCAACTCTAGAATTTCTATGTGG + Intronic
1047392308 8:124462618-124462640 TCATCTCTAGAAGTTTGATACGG + Intergenic
1047436672 8:124840580-124840602 TCCCCTCCTGAAGTTCACTGTGG + Intergenic
1049314681 8:141957749-141957771 CCATTTCTAGAAGTTCAATTTGG - Intergenic
1050094097 9:2046292-2046314 TAAACTCCTGAAGTTCAATGCGG + Intronic
1050160131 9:2710182-2710204 TAAACTTTTGAAGGTCAATGGGG + Intergenic
1050247801 9:3709348-3709370 TCATCTCTAGAAGTTCAATTTGG - Intergenic
1052145905 9:25049093-25049115 TCATGTCTTGAAATGCAATCTGG - Intergenic
1053855509 9:42334425-42334447 TAATCTCTTAAAGGTCAATCTGG + Intergenic
1056272857 9:84963922-84963944 TCATTTCTGGAAGTTCAATATGG + Intronic
1056422481 9:86442727-86442749 TCATTTCTAGAAGTTCTATTTGG + Intergenic
1056618551 9:88190390-88190412 TCATCTCTAGAAGTTTGATTTGG + Intergenic
1057141993 9:92732145-92732167 TCGTCTCTAGAAGTTCTATCTGG - Intronic
1057172668 9:92972913-92972935 TCATCTCTGGAAGTTTAATGTGG + Intronic
1058764754 9:108170980-108171002 TCATCTGTTGAAGGACACTGGGG - Intergenic
1058789301 9:108425463-108425485 TCATCACTTGAGGTTACATGTGG + Intergenic
1058835920 9:108858500-108858522 TCTACTCTTGAAGTTCTACGGGG + Intergenic
1059490410 9:114661918-114661940 TCAACTCTTGGAGATCAAGGTGG - Intergenic
1059640615 9:116213221-116213243 TCCTCTCTTCAAATGCAATGAGG - Intronic
1203366770 Un_KI270442v1:265462-265484 TCATCTCTAGAAGTTCAAGCTGG - Intergenic
1187777936 X:22784726-22784748 TCATCTCTTGCAACTCAAAGTGG - Intergenic
1187923523 X:24229317-24229339 TCATCTCTTGAAGTTTGATTTGG + Intergenic
1188795612 X:34460537-34460559 TTATCTTCTGATGTTCAATGAGG - Intergenic
1190387988 X:49901984-49902006 TCATCTTTACAAATTCAATGTGG - Intergenic
1190507375 X:51139440-51139462 TTATAACTTGTAGTTCAATGGGG - Intergenic
1190865201 X:54378560-54378582 TCATCTCTAGAAGTTCAATTTGG - Intergenic
1190891695 X:54573677-54573699 TCATCTCTAGAAATTAAATTTGG + Intergenic
1192941277 X:75914031-75914053 TTATCTCTAGAAGTTCAGTATGG + Intergenic
1194072880 X:89349749-89349771 TCAGCTCTAGAAGTTCAATTAGG + Intergenic
1194345990 X:92766357-92766379 CCATCTCTTGCAGTTTAGTGGGG + Intergenic
1195583164 X:106531803-106531825 TCACCTCTTGAAGAACACTGGGG + Intergenic
1196595061 X:117536430-117536452 TCATTTCTAGAAGTTCAATTTGG + Intergenic
1196768481 X:119270986-119271008 TCATCTTCTGAAGCTCAAAGAGG - Intergenic
1197823476 X:130564640-130564662 TCCTTTCTTGAAGTTAGATGTGG + Intergenic
1197989080 X:132297671-132297693 TCATCTCTAGAAGTTCAATTTGG + Intergenic
1199674829 X:150179581-150179603 TCATTTTTAGAAGTTCAATTTGG + Intergenic
1199898579 X:152150513-152150535 CCACCTCTTGAAGTTAGATGTGG + Intergenic
1200173080 X:154093237-154093259 TTATCTTTTGAGGTTCAGTGAGG + Intronic
1200316136 X:155135157-155135179 TCATCTCTAGAAGTTCCATTTGG - Intronic
1200727120 Y:6685489-6685511 TCAGGTCTAGAAGTTCAATTAGG + Intergenic
1200728272 Y:6701264-6701286 TCAGGTCTAGAAGTTCAATTAGG + Intergenic
1201071910 Y:10154767-10154789 TCATCTCTAGAAGTTCCAGCTGG + Intergenic