ID: 1021232395

View in Genome Browser
Species Human (GRCh38)
Location 7:18101521-18101543
Sequence TCTTCCATGTAAAACCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021232392_1021232395 -10 Left 1021232392 7:18101508-18101530 CCCATTCCTTTTCTCTTCCATGT 0: 1
1: 0
2: 4
3: 77
4: 796
Right 1021232395 7:18101521-18101543 TCTTCCATGTAAAACCTTGTTGG No data
1021232388_1021232395 22 Left 1021232388 7:18101476-18101498 CCTCTTACTCAGTCTTCTTTGGA 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1021232395 7:18101521-18101543 TCTTCCATGTAAAACCTTGTTGG No data
1021232386_1021232395 23 Left 1021232386 7:18101475-18101497 CCCTCTTACTCAGTCTTCTTTGG 0: 1
1: 0
2: 4
3: 31
4: 324
Right 1021232395 7:18101521-18101543 TCTTCCATGTAAAACCTTGTTGG No data
1021232390_1021232395 -8 Left 1021232390 7:18101506-18101528 CCCCCATTCCTTTTCTCTTCCAT 0: 1
1: 0
2: 11
3: 104
4: 1244
Right 1021232395 7:18101521-18101543 TCTTCCATGTAAAACCTTGTTGG No data
1021232391_1021232395 -9 Left 1021232391 7:18101507-18101529 CCCCATTCCTTTTCTCTTCCATG 0: 1
1: 0
2: 8
3: 83
4: 816
Right 1021232395 7:18101521-18101543 TCTTCCATGTAAAACCTTGTTGG No data
1021232385_1021232395 28 Left 1021232385 7:18101470-18101492 CCAATCCCTCTTACTCAGTCTTC 0: 1
1: 0
2: 5
3: 43
4: 342
Right 1021232395 7:18101521-18101543 TCTTCCATGTAAAACCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021232395 Original CRISPR TCTTCCATGTAAAACCTTGT TGG Intronic
No off target data available for this crispr