ID: 1021234460

View in Genome Browser
Species Human (GRCh38)
Location 7:18125163-18125185
Sequence GGGGGGTACCCTCATTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021234460_1021234471 23 Left 1021234460 7:18125163-18125185 CCTGGGGAATGAGGGTACCCCCC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1021234471 7:18125209-18125231 CATATCAATTCCTGCCACCCGGG 0: 1
1: 0
2: 1
3: 15
4: 201
1021234460_1021234470 22 Left 1021234460 7:18125163-18125185 CCTGGGGAATGAGGGTACCCCCC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1021234470 7:18125208-18125230 CCATATCAATTCCTGCCACCCGG 0: 1
1: 0
2: 0
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021234460 Original CRISPR GGGGGGTACCCTCATTCCCC AGG (reversed) Intronic
900162110 1:1228739-1228761 GTGGGGTCCCCTCATTGGCCTGG - Exonic
900537919 1:3187923-3187945 GGGGGGTACGCCCGTTCCACAGG - Intronic
902860624 1:19242703-19242725 GGGCTGTTCCCTCCTTCCCCTGG + Intronic
903697142 1:25216153-25216175 GTGTGCTAGCCTCATTCCCCTGG - Intergenic
904211051 1:28887229-28887251 GGGGGCGACCCTCGGTCCCCGGG + Intronic
904599482 1:31665697-31665719 GGGGGGCACCCTCAAACCCATGG + Intronic
905982447 1:42241735-42241757 GTGGTGTGTCCTCATTCCCCTGG - Intronic
912723971 1:112042862-112042884 CGGGGGTGACCCCATTCCCCTGG - Intergenic
914256223 1:145962523-145962545 GGGGGGCACCCGGATTCCCTTGG + Exonic
916167651 1:161978130-161978152 GGAGAGTTCCCTGATTCCCCTGG + Intergenic
918078106 1:181185672-181185694 GGTGGGCACCCTCATTGTCCTGG + Intergenic
919811725 1:201412936-201412958 GGGAGGTCCCCTCCTTCCACAGG - Intronic
1063074369 10:2700192-2700214 GGGGCGTCCCCACATGCCCCTGG - Intergenic
1064031475 10:11885820-11885842 GGGGGGCACCCTTGTTCCTCTGG - Intergenic
1064123480 10:12638994-12639016 GGGCGGGAACCTCATTCCTCTGG + Intronic
1067460561 10:46455180-46455202 TGGAGGTCCTCTCATTCCCCTGG - Intergenic
1067626631 10:47929423-47929445 TGGAGGTCCTCTCATTCCCCTGG + Intergenic
1069061168 10:63895931-63895953 GGAGGGTATCCTTATTTCCCAGG - Intergenic
1069760715 10:70809301-70809323 GGGGGGCACCCTAATTCACAAGG - Intergenic
1072859082 10:98983945-98983967 AGGGGCGACCCTCATTGCCCAGG + Intronic
1074458396 10:113615035-113615057 GGTGGGTCCCCTCCCTCCCCTGG + Intronic
1074779113 10:116787874-116787896 TGGGGGCACCCTAAATCCCCTGG + Intergenic
1074873279 10:117594716-117594738 GAGGGGGACCCTCTTCCCCCAGG + Intergenic
1075799348 10:125143151-125143173 GGGGTGCACCTTCATTCCACAGG + Intronic
1080469980 11:32536153-32536175 GGGGTCTACTCTCATTCCCCAGG + Intergenic
1083755406 11:64789363-64789385 GGGGGCTCCCCTCCCTCCCCAGG + Exonic
1088944491 11:114495765-114495787 AAGGGGTTCCCTTATTCCCCAGG + Intergenic
1090056528 11:123429528-123429550 GGGGGGTACCCTCGACTCCCTGG + Intergenic
1090420584 11:126572556-126572578 GGGGGGTCCCCTCTTCCCACTGG - Intronic
1091765803 12:3119319-3119341 GGGGGGTTCACTGACTCCCCAGG + Intronic
1096576642 12:52556960-52556982 GTGGGGTTCCCTCAGGCCCCAGG + Intergenic
1103166185 12:118772694-118772716 GGAGAGTTCCCTGATTCCCCTGG + Intergenic
1103945888 12:124526297-124526319 TGGGGGTTCACACATTCCCCTGG - Intronic
1108159478 13:47623107-47623129 GGGAGGTAGCTTCATTCCCGGGG - Intergenic
1113328816 13:109309467-109309489 GGGGGGCACCCTCTTTCCTGGGG + Intergenic
1118692572 14:68353905-68353927 GTGGGGTACCCTCAAGCCCATGG + Intronic
1119512492 14:75222339-75222361 GGGAAGTACACTCACTCCCCAGG + Intergenic
1123645400 15:22434116-22434138 GGGGGTTAGCCTTCTTCCCCAGG + Intergenic
1133509071 16:6440407-6440429 GGCAGGTACCCAGATTCCCCTGG - Intronic
1135621736 16:23961870-23961892 TTGGGGTGCCCTCATTTCCCAGG + Intronic
1136316673 16:29458472-29458494 GGGGGATGCCCTCCTTCCACGGG + Intergenic
1136318719 16:29468746-29468768 GGGGGATGCCCTCCTTCCACAGG + Intergenic
1136431249 16:30197814-30197836 GGGGGATGCCCTCCTTCCACGGG + Intronic
1136433291 16:30208090-30208112 GGGGGATGCCCTCCTTCCACAGG + Intronic
1141019492 16:80481856-80481878 GTGGAGGACCCTCCTTCCCCTGG + Intergenic
1141935813 16:87237093-87237115 TGGGGGAACCCTAATTCCCCAGG + Intronic
1142400600 16:89856280-89856302 CTGGGGTTCCCCCATTCCCCTGG + Intronic
1142425622 16:90000852-90000874 AGGGGGTACCCTGAGTCCCTGGG + Intergenic
1143381787 17:6501244-6501266 GGGGTGTCACCCCATTCCCCAGG - Intronic
1151436395 17:74100259-74100281 GAACGGTTCCCTCATTCCCCTGG + Intergenic
1151740450 17:75978790-75978812 GGGGGATATCGCCATTCCCCAGG - Intronic
1153086645 18:1296340-1296362 GGAGAGTTCCCTGATTCCCCTGG + Intergenic
1154123607 18:11671160-11671182 GGGGCGTCCCCTGATGCCCCTGG + Intergenic
1156579903 18:38362871-38362893 AGTGGGTACTCTCATTCCCCTGG - Intergenic
1157171639 18:45412277-45412299 GGGAGGTACACTGATTTCCCAGG - Intronic
1157579382 18:48764589-48764611 GGGGGGTTCCCTTCTTGCCCTGG - Intronic
1159763431 18:72456440-72456462 GGTGGGAACCCTCCTTCCCCAGG + Intergenic
1160771126 19:831712-831734 GGGGGGTGCCCCCGTCCCCCTGG - Exonic
1163495003 19:17641252-17641274 GGTGGGTTCCGTAATTCCCCTGG - Intronic
1164733871 19:30526245-30526267 GGCAGGTACTCTCAGTCCCCAGG - Intronic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1166047430 19:40237782-40237804 GGTGGCTGCCCTCATTCACCAGG - Intronic
1166047444 19:40237826-40237848 GGTGGCTGCCCTCATTCGCCAGG - Intronic
928356561 2:30621747-30621769 TGTGGGTACTCTCATTCCCAGGG + Intronic
931638702 2:64362867-64362889 GGGAGGCACCTGCATTCCCCAGG - Intergenic
941006117 2:160248826-160248848 GGTGGGTACCCTCTCTGCCCTGG - Intronic
949017375 2:241720946-241720968 GGGCGGTCCCCTCAGGCCCCCGG + Intronic
949043366 2:241859287-241859309 GGGGGCCACCCACCTTCCCCAGG - Intergenic
1171385885 20:24769350-24769372 GGGGGGTCCCCTCTTGCCTCTGG + Intergenic
1171989442 20:31684504-31684526 GGGAGGTCCCATCCTTCCCCTGG - Intronic
1175598684 20:60255551-60255573 GGGGAGCACCCTCTTTCCTCTGG - Intergenic
1176104889 20:63381290-63381312 GGGGGTCCCCCTCATTCCCCTGG + Intergenic
1179279835 21:39924970-39924992 CAGGTGTACCCTCATGCCCCTGG - Intronic
1180150075 21:45942932-45942954 GGGGGCTCCCCCCATTCCCTGGG - Intergenic
1180398855 22:12389287-12389309 GTGGGGCACCCCCATTGCCCAGG + Intergenic
1181759623 22:25049244-25049266 GGGGGGCATCCTCCTTCTCCAGG - Exonic
1183667433 22:39253839-39253861 GGGGGCTGCCTTCCTTCCCCAGG + Intergenic
1183684606 22:39354468-39354490 GGGGGGCAGCTTCATACCCCTGG + Intronic
1185097883 22:48821554-48821576 GGGGGGTCGCCTCTCTCCCCTGG + Intronic
950465504 3:13150984-13151006 GGGGGCTGCCCTCATCCTCCTGG + Intergenic
950629829 3:14275024-14275046 GGGGGCTTCCCTCCTGCCCCTGG + Intergenic
953378357 3:42447579-42447601 GGGTGGTACACCCATCCCCCAGG + Intergenic
954275781 3:49540637-49540659 TGGGGGTACCCTGAAACCCCAGG + Intergenic
960676461 3:120200153-120200175 GGGGGATCCCCACAGTCCCCTGG + Intronic
979319893 4:119311037-119311059 AGGGAGTACCCTTAATCCCCAGG - Intergenic
982101830 4:151975715-151975737 TGGGGGTACCATCACTTCCCAGG + Intergenic
985583576 5:713815-713837 GGGCGGTACCCTCATTGCAGTGG - Intronic
985597089 5:798112-798134 GGGCGGTACCCTCATTGCAGTGG - Intronic
986825195 5:11512728-11512750 GAGGTCTTCCCTCATTCCCCTGG - Intronic
1002140334 5:177133894-177133916 GGGGGTGACCCTCATTACACTGG - Intronic
1017810828 6:157982146-157982168 GGGGGGTACCCGTCTTCCCGAGG - Intronic
1018198456 6:161375159-161375181 GGGGGGTTCCCTCCACCCCCAGG - Intronic
1018907497 6:168083996-168084018 TCGGGGTACCCTCTGTCCCCAGG - Intergenic
1021234460 7:18125163-18125185 GGGGGGTACCCTCATTCCCCAGG - Intronic
1022506206 7:30909943-30909965 GGGAGGCTCCCTCATGCCCCTGG - Intergenic
1032400302 7:131619920-131619942 GGGGGGCTCCCGCATTCCTCCGG - Intergenic
1032950276 7:136901134-136901156 TGGGGGTGCCCACACTCCCCGGG - Intronic
1034531201 7:151697355-151697377 CAGGGGTACCATCATTCCCCAGG + Intronic
1049094896 8:140542741-140542763 GGGGGGTCCCCTCTGTGCCCTGG + Intronic
1049814765 8:144593079-144593101 GCCGGGTACCCTGAGTCCCCTGG - Intronic
1055000614 9:71445841-71445863 GTGGTGTATCCTCCTTCCCCAGG + Intronic
1056079012 9:83071595-83071617 GGGGGGTTTCATCATTGCCCAGG + Intergenic
1057335037 9:94148822-94148844 GGTGGGTACCCTAAAGCCCCAGG - Intergenic
1057972201 9:99568913-99568935 GGGGAGTATGCTCATTGCCCTGG - Intergenic
1060183970 9:121552633-121552655 GGGGTGCACACACATTCCCCAGG - Intergenic
1061509652 9:131052772-131052794 GGGGGCTACCCCCCATCCCCAGG + Intronic
1061912534 9:133732613-133732635 GGTGGGTGCCATCACTCCCCAGG + Intronic
1203380102 Un_KI270435v1:28668-28690 GTGGGGCACCCCCATTGCCCAGG + Intergenic
1190580895 X:51892730-51892752 GAGGGGTACCCTTAGTCCCCAGG + Intronic
1193244375 X:79211385-79211407 GAGGGGTGCCCCCATTGCCCAGG - Intergenic
1199575796 X:149312628-149312650 GGAGGGCTGCCTCATTCCCCTGG - Intergenic
1199852928 X:151738250-151738272 GGGGAGTACCCTCATTTTCTTGG + Intergenic