ID: 1021236260

View in Genome Browser
Species Human (GRCh38)
Location 7:18146016-18146038
Sequence CAGCATGAAGACTCTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021236260_1021236265 25 Left 1021236260 7:18146016-18146038 CCAGCAAAAGAGTCTTCATGCTG 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1021236265 7:18146064-18146086 AAGAAAAAGAGATCAAGAAAAGG No data
1021236260_1021236264 -4 Left 1021236260 7:18146016-18146038 CCAGCAAAAGAGTCTTCATGCTG 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1021236264 7:18146035-18146057 GCTGATTGGTTGGGAAAAAAAGG 0: 1
1: 0
2: 1
3: 23
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021236260 Original CRISPR CAGCATGAAGACTCTTTTGC TGG (reversed) Intronic
900715882 1:4143300-4143322 GACCCTGAAGACTCTTTAGCTGG - Intergenic
907538560 1:55189586-55189608 CAGCATGAGGTTTCTTTTGGAGG + Intronic
907839827 1:58145974-58145996 CAGCATGAAGACCTTTATGATGG + Intronic
910298349 1:85676034-85676056 CAGCAATAAGACTGTTTTACTGG + Intronic
911258238 1:95657137-95657159 TAGCATGAAGACACTGATGCAGG + Intergenic
916168962 1:161986439-161986461 AGGCATGAACACTGTTTTGCAGG + Intronic
920649620 1:207827015-207827037 CGGCATGAAGACTGCTTTTCTGG - Intergenic
920736833 1:208540475-208540497 CTGAATGAAGACTCTTTTTTAGG - Intergenic
922852467 1:228745273-228745295 CAGCCTGAACACTCAGTTGCAGG + Exonic
922970128 1:229729187-229729209 AAGCATCCAGACCCTTTTGCTGG + Intergenic
924920737 1:248626705-248626727 CCGCAAGAAGTGTCTTTTGCTGG - Exonic
1064954527 10:20893050-20893072 CAGCAGGAAGAATATTTTCCAGG - Intronic
1067107409 10:43375363-43375385 CAGAATGATGCCTCTGTTGCTGG + Intronic
1070493655 10:77000707-77000729 CAGAATGATGACTATTTTGAAGG - Intronic
1073281167 10:102355175-102355197 CAGCATGCACACTCTTGTGATGG - Intronic
1074879974 10:117648292-117648314 CATTATGAAGACCATTTTGCTGG + Intergenic
1076220574 10:128730106-128730128 CAGCCTGCAGAATCTTGTGCTGG - Intergenic
1082616430 11:55366525-55366547 CAACATGATGACATTTTTGCTGG - Intergenic
1082626237 11:55490080-55490102 CAACATGATGACATTTTTGCTGG - Intergenic
1085331578 11:75656335-75656357 CTGAATGAAGAGGCTTTTGCAGG - Intronic
1086872421 11:92054688-92054710 CAGCATGAATACATTCTTGCAGG - Intergenic
1087338548 11:96873693-96873715 TAGCAAGAAGACTCTTTAGTAGG - Intergenic
1088637551 11:111837745-111837767 CAGCATGAAGCCTGCTCTGCAGG + Intronic
1091816126 12:3439569-3439591 CAGCAGAAAAACTCCTTTGCTGG + Intronic
1095187861 12:39222538-39222560 CAGCATTATGACTGTTTTGATGG - Intergenic
1096028279 12:48387217-48387239 CTGGATGGAGACTCTTTTGTGGG + Intergenic
1096296965 12:50392186-50392208 CAGCATGAAGAAACTTTTGGGGG + Intronic
1098006380 12:66000931-66000953 CAGCATGAAGACTTCTCTGCAGG - Intergenic
1098131208 12:67352308-67352330 CAACTTGAAGAGTCTTTTGATGG - Intergenic
1106813701 13:33384790-33384812 CAGCATGCAGTCTTTTTTGAGGG - Intergenic
1107105021 13:36633708-36633730 CAGCATGAAGCCTCTTTATAAGG - Intergenic
1107793112 13:44022597-44022619 CACCATGAAGACTCTGCTCCTGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112832306 13:103468275-103468297 CAGCAGGAAGACTAATTTACAGG + Intergenic
1113026255 13:105944544-105944566 CAGCAGGAAAACACATTTGCTGG + Intergenic
1115178603 14:30595149-30595171 CAGGATGAAGCCTGTTTTGTTGG + Intronic
1116254261 14:42530348-42530370 GAGCATGAAGAAACTCTTGCAGG - Intergenic
1119371155 14:74144478-74144500 CAGCAAAAAGATTCTTTTTCTGG + Intronic
1119496206 14:75081522-75081544 CATCATGAATACTTTTTTGGAGG + Exonic
1120587191 14:86327520-86327542 CAGTATGAAGATTCATTTGAAGG - Intergenic
1122051878 14:99066363-99066385 GAGGATGAACCCTCTTTTGCTGG - Intergenic
1122759537 14:104012247-104012269 CAGCATGCATACTCTTATCCAGG + Intronic
1127083014 15:55398875-55398897 CAGCATGAAAACTTTTTTGAAGG + Intronic
1127756450 15:62097208-62097230 CAGCATCATGACTCCTTTTCAGG - Intergenic
1127978725 15:64018386-64018408 CAGCCTTAAGACTCTTTTACTGG + Intronic
1133699831 16:8298627-8298649 CAGCATGAAGAGGCCTTTTCTGG - Intergenic
1133837494 16:9379766-9379788 AAAAATGAAGACTATTTTGCTGG + Intergenic
1133849236 16:9486238-9486260 CAGCAGGAAGATTCCTGTGCTGG - Intergenic
1135876047 16:26200927-26200949 CAGGGTGAAGGCTCTTTTTCTGG + Intergenic
1137384237 16:48026838-48026860 CTGCATGAAGCCTCTTTTAGAGG + Intergenic
1137414869 16:48266471-48266493 GAGCATGAAGAAACTTTTGGAGG - Intronic
1138322347 16:56126410-56126432 CCCCATTAAGACTCTTTTCCAGG + Intergenic
1141379285 16:83561147-83561169 CGGCCTGAAGTCTCTTTTGAAGG - Intronic
1143341731 17:6216338-6216360 CAGAATGACCACTCTTTAGCTGG + Intergenic
1146738776 17:35262865-35262887 CAGCATGGAGACTTTTTTTTGGG - Intronic
1149068076 17:52504159-52504181 CAGCAGGAAAACACTTTTCCTGG - Intergenic
1149284091 17:55142729-55142751 CAGCATGAAAACACTTTGCCAGG - Intronic
1149367647 17:55961893-55961915 CAGTAAGAAGACTCTCTTACTGG - Intergenic
1159283538 18:66318535-66318557 CAGCATTAAGACTGGTTTGGGGG + Intergenic
1159385285 18:67716729-67716751 TAGCATGGAGAATCTTCTGCTGG - Intergenic
1159795344 18:72836295-72836317 CAACTTGAAGTCTCTTTTTCAGG + Intronic
1160616664 18:80135917-80135939 CAGCATGAAGAAGCATGTGCTGG + Exonic
1160619703 18:80162118-80162140 CAGCATGAGGACTGTCTTCCTGG + Intronic
1162355954 19:10184937-10184959 CAGCATGAGGAATGCTTTGCTGG + Intronic
1163241374 19:16065910-16065932 CAGCATCAAGACTCCTGTGTGGG - Intergenic
1165246219 19:34499995-34500017 CAACATGAAGACTCTTCCGCCGG - Intronic
1167671825 19:50858025-50858047 CAGCAAGATCACGCTTTTGCTGG - Exonic
927551538 2:24005126-24005148 TAGCATGAAGACTCTTTAGTAGG + Intergenic
927934509 2:27068723-27068745 CTGCATCAAGACTCGATTGCAGG + Exonic
928490183 2:31775264-31775286 CAGAATGAAGACTGTACTGCTGG + Intergenic
930455592 2:51604620-51604642 GAGCTTGAAGACTATCTTGCTGG - Intergenic
930688035 2:54330292-54330314 CAGCAGGGAGCCTCATTTGCAGG + Intronic
932111168 2:69002167-69002189 AAGCTTGAAGACTTTTTTGTAGG - Intergenic
934864805 2:97798022-97798044 CAGCCTGAAGACCCTTCAGCTGG - Intronic
936249537 2:110857295-110857317 CAGCATGGAAACTTTTTTTCCGG + Intronic
936651110 2:114426973-114426995 CAGAATGAAAACTATCTTGCTGG - Intergenic
938765714 2:134459586-134459608 CAGCAGGCAGACTCTTCTGCGGG - Intronic
939862249 2:147434316-147434338 CAGAGGGAAGTCTCTTTTGCAGG + Intergenic
941469445 2:165866159-165866181 CAGCCTGAAGAGGCTTCTGCTGG + Intronic
942805386 2:179925807-179925829 ATGCTTGAAGATTCTTTTGCTGG + Intergenic
946321676 2:218958440-218958462 AAGCCTGAAGGCTCTTGTGCTGG + Intergenic
946717392 2:222566962-222566984 CAGAATGAAACCTATTTTGCTGG - Intergenic
1170003880 20:11645513-11645535 CAGGATGCAAACTCTTGTGCAGG + Intergenic
1172172808 20:32951586-32951608 AAGCAGGAAGAAACTTTTGCAGG + Intronic
1179122502 21:38560702-38560724 CTACATGAAGACTCATTTTCTGG + Intronic
954275526 3:49539545-49539567 CAGCATGAAGACCGGGTTGCTGG + Intergenic
954661979 3:52231212-52231234 CAGGATGACCTCTCTTTTGCTGG - Exonic
954762368 3:52885447-52885469 AGGCATGATGACTCTTTTGAGGG + Intronic
954946340 3:54427889-54427911 CAGCAAGGAGCTTCTTTTGCGGG + Intronic
955641881 3:61094672-61094694 CAGCATTACTACTCTTGTGCTGG + Intronic
957594587 3:82246242-82246264 GATCATGAAGAGTCTTTTGTGGG - Intergenic
959143582 3:102516752-102516774 CACCAAGAAGACTCATATGCTGG - Intergenic
959925618 3:111918541-111918563 AAGCATGAATGCTCATTTGCAGG + Intronic
960331773 3:116368546-116368568 CTGCATGAAGAGTCTTTGGTTGG + Intronic
960461227 3:117938391-117938413 CAGCAAGAAGACTATTTGGCTGG - Intergenic
963239951 3:142992822-142992844 AAGCATGAAGACTCCTTTAAGGG + Intronic
964915772 3:161839369-161839391 CAGCATGAGGGCTCTCTTCCAGG - Intergenic
965234546 3:166099305-166099327 CAGGATGAATATTCTTTTGATGG + Intergenic
965427485 3:168545722-168545744 CAGCCAGCAGATTCTTTTGCTGG + Intergenic
965664028 3:171072683-171072705 CAGCACTAAGAGTCTTTTGGAGG - Intronic
966759390 3:183403312-183403334 GAGCGCTAAGACTCTTTTGCTGG - Intronic
969119639 4:4898727-4898749 CAGCAGGAAGCCTCCTTGGCCGG - Intergenic
974133760 4:57788931-57788953 CAGCCTGAAGAATCTTGAGCAGG + Intergenic
974140248 4:57877380-57877402 CACCAGGATGACTCTTGTGCAGG + Intergenic
975901310 4:79156472-79156494 CAGCATGAAGACCCTCTTCCTGG - Intergenic
976486236 4:85608361-85608383 CAGCATGGAAACTGTTTGGCTGG - Intronic
978865773 4:113508604-113508626 CAGAATGAAGACACAATTGCAGG + Intronic
979983485 4:127286677-127286699 CAGCATACAGACTCTATTGACGG - Intergenic
982271699 4:153596485-153596507 CAGGATGAAGGCTGTGTTGCGGG + Intronic
983379957 4:166980434-166980456 CAGCATGAAACCTCTGTGGCTGG + Intronic
983436700 4:167724541-167724563 GAGCATGCAGACCCTTTTGCCGG - Intergenic
984506447 4:180624978-180625000 AAGGATTAAGATTCTTTTGCGGG + Intergenic
984677057 4:182561768-182561790 CAGCATGAATTCCCTTTTGATGG - Intronic
987029425 5:13962139-13962161 CAGCATGAGGAAGCTTTTGAAGG - Intergenic
988726876 5:33935391-33935413 TAGCATCAGGACTCTTTTTCAGG - Intergenic
989477894 5:41895180-41895202 CAGCATGAATCTGCTTTTGCAGG - Intergenic
992069856 5:73138312-73138334 CAGCATGTAGCCTCTTCTGCAGG + Intergenic
992577483 5:78131676-78131698 TATCGTGAAGACTCTTTTGATGG - Intronic
993141984 5:84045409-84045431 CAGCATAAAGATTCTTTGACTGG + Intronic
995663348 5:114511070-114511092 CAGCCTGAAGAAGCTTTCGCTGG + Intergenic
996197460 5:120626474-120626496 GAGCATGAGGGATCTTTTGCAGG + Intronic
997386762 5:133479706-133479728 CGGCATCAAGTTTCTTTTGCAGG + Intronic
997793181 5:136781478-136781500 CAGCAAGAAGCATGTTTTGCAGG + Intergenic
999257869 5:150219806-150219828 CAGCATGAAAACACGTTTACAGG - Intronic
999723264 5:154414615-154414637 GAGCATGAGGACACTTTTGCGGG + Intronic
1001663775 5:173415940-173415962 CAGCGTGAAGTCTCTTGTGTTGG + Intergenic
1001761302 5:174210368-174210390 CAGCATGCAGCCTCTATTCCTGG + Intronic
1005247683 6:23907467-23907489 GAGCTTGAAGACTATCTTGCTGG + Intergenic
1005403355 6:25458628-25458650 GAGTATGAAGATTCTTTTGATGG + Intronic
1008274465 6:49526821-49526843 CAGCATGGAGACTCTTCAGGAGG - Exonic
1014846662 6:126286079-126286101 CAGCATGGAGTTTCTTTTGGTGG + Intergenic
1017028271 6:150199404-150199426 CTGCATGAAGCCTCTTTCACAGG - Intronic
1021236260 7:18146016-18146038 CAGCATGAAGACTCTTTTGCTGG - Intronic
1024607392 7:51033761-51033783 AAGAATGCAGACTCCTTTGCAGG - Intronic
1028054392 7:86225098-86225120 CAGCTGGAAGCCTCTTTGGCTGG + Intergenic
1028765751 7:94557541-94557563 CATCAAGAAGAATCTTTTTCAGG - Intergenic
1028871702 7:95777326-95777348 CAGCCTGAAAACTATCTTGCAGG + Intronic
1030982458 7:116202310-116202332 CAGCTTGAAGAGTCTCTTGCTGG - Intergenic
1031501326 7:122521453-122521475 CAAGATTAAGACTTTTTTGCGGG + Intronic
1042655122 8:71087457-71087479 CACCATGAAGCATCATTTGCAGG - Intergenic
1048325230 8:133434123-133434145 CAGCAGGAAGCTTCCTTTGCTGG + Intergenic
1051976535 9:22956944-22956966 CAGCATGAACAGCCTTTTCCTGG - Intergenic
1052565629 9:30146453-30146475 CAGGTTGCAGACTTTTTTGCTGG - Intergenic
1056091675 9:83211912-83211934 CAGCATGAAGACCCATTGTCAGG + Intergenic
1057118466 9:92548238-92548260 CATCATGAAAGCTCTCTTGCTGG + Intronic
1061257836 9:129463086-129463108 CAGCATGAGGAAACTTTTGTTGG + Intergenic
1061262893 9:129489778-129489800 CAGCATGAACACGCTTTCCCAGG - Intergenic
1187996374 X:24931393-24931415 CAGCATGGGGATTCTTATGCGGG - Intronic
1188008014 X:25030553-25030575 CAACATGAAGATTCTTTTCTTGG + Intergenic
1188196654 X:27242739-27242761 CAGCAGGAAAACTCTTCTTCAGG - Intergenic
1189808154 X:44755489-44755511 CTGCAAGCAGACTCTTTTTCTGG + Intergenic
1191800683 X:65075786-65075808 CAACATGAAGACTTTTTAGGGGG - Intergenic
1193320187 X:80112890-80112912 AACCATAAAGACTGTTTTGCTGG - Intergenic
1196311904 X:114178120-114178142 CAGGAAAAAGGCTCTTTTGCTGG + Intergenic
1197868325 X:131042026-131042048 CATCATGAACATTCTATTGCTGG + Intergenic
1198593048 X:138205520-138205542 CAGCATTAACCCTCTTTTGGAGG - Intergenic
1198640417 X:138749934-138749956 CAGCATGAAGACTAGTATGGTGG + Intronic
1199210222 X:145199669-145199691 AAGCATGAATACACATTTGCAGG + Intergenic