ID: 1021236879

View in Genome Browser
Species Human (GRCh38)
Location 7:18153333-18153355
Sequence CCCTGTTATGGAATTTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 19, 3: 70, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021236874_1021236879 -1 Left 1021236874 7:18153311-18153333 CCTGAGCATAGGGGCTCAAGAGC 0: 16
1: 60
2: 92
3: 142
4: 548
Right 1021236879 7:18153333-18153355 CCCTGTTATGGAATTTTCTGGGG 0: 1
1: 0
2: 19
3: 70
4: 311
1021236870_1021236879 16 Left 1021236870 7:18153294-18153316 CCACGGGGTGGGAGTGGCCTGAG 0: 1
1: 0
2: 14
3: 63
4: 328
Right 1021236879 7:18153333-18153355 CCCTGTTATGGAATTTTCTGGGG 0: 1
1: 0
2: 19
3: 70
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021236879 Original CRISPR CCCTGTTATGGAATTTTCTG GGG Intronic
901383417 1:8890506-8890528 CCCTGTTACAGAATTTTCTGGGG - Intergenic
901737472 1:11321566-11321588 ACCTGTTGTAGAATTTACTGAGG - Intergenic
903979944 1:27178536-27178558 CCCTGTTACATAATTTTCTGGGG - Intergenic
904492658 1:30870429-30870451 GCCTGTGATGGAGTGTTCTGAGG - Intronic
905187421 1:36206637-36206659 CCCTATTACAGAATTTTCTGGGG - Intergenic
905216482 1:36411955-36411977 CCTGGTTACAGAATTTTCTGGGG + Intergenic
905966314 1:42099843-42099865 TCCTGTTATGTAATATTTTGTGG - Intergenic
906588785 1:47004164-47004186 CCCCGTTACAGAATTTTCTGGGG - Intergenic
906601137 1:47130317-47130339 CCCTGTTAGGAAATCTGCTGGGG + Intergenic
907183276 1:52589450-52589472 CCCCTTTACAGAATTTTCTGGGG - Intergenic
908115986 1:60940745-60940767 CCCGTTTACAGAATTTTCTGGGG + Intronic
909295588 1:73943975-73943997 CCCTGATCAGGGATTTTCTGAGG + Intergenic
909514993 1:76497117-76497139 CCCTAATTTGGAATTCTCTGTGG + Intronic
911211409 1:95142570-95142592 CCCGGTTACAGAATTTTCTAGGG + Intronic
912450462 1:109764839-109764861 CCCTGTGATGGAGTGTCCTGTGG + Intronic
913282253 1:117197611-117197633 CCCTGTTACAGAGTTTTCAGGGG - Intronic
913414704 1:118592135-118592157 CCCTTCCATGGAATTCTCTGTGG - Intergenic
915901896 1:159853526-159853548 CCTTATGATGGAATATTCTGTGG - Intronic
916184633 1:162118901-162118923 CCCTGTTGATGAGTTTTCTGAGG - Intronic
916502129 1:165396344-165396366 CCAGGATATGGCATTTTCTGTGG - Intergenic
916625734 1:166553146-166553168 TCCAGTTACAGAATTTTCTGAGG - Intergenic
916626239 1:166558289-166558311 CCCGGTTGCAGAATTTTCTGGGG - Intergenic
916639978 1:166717374-166717396 TCCCGTTACTGAATTTTCTGGGG - Intergenic
916640684 1:166725678-166725700 CCCTGTTACTGAATTTTCTGGGG - Intergenic
918059921 1:181052316-181052338 CCATGTCATGTAAATTTCTGGGG - Exonic
918168838 1:181975698-181975720 CCCTCTTCTGCAATTTGCTGGGG - Intergenic
918753628 1:188306831-188306853 CCCTTTTTTGGAATTTCCTTTGG + Intergenic
919609723 1:199730532-199730554 TACTGTTATGCAATTTTCAGAGG + Intergenic
920950601 1:210568612-210568634 CCCCGTTAGAGAATTTTCTGGGG + Intronic
922184193 1:223259526-223259548 TCCAGTTATAGAAATTTCTGGGG - Intronic
922333665 1:224600676-224600698 CCCATTTATGGAATTTTTTATGG + Intronic
923718679 1:236448692-236448714 CCCTGCTATGCAAATTTCTTAGG + Intronic
924942527 1:248821933-248821955 GCCTGTTTCGGTATTTTCTGAGG - Intronic
1063865542 10:10361523-10361545 GACTGTCATGGAAATTTCTGTGG + Intergenic
1064352003 10:14585104-14585126 CCCGGTTACAGAATTTTCTTGGG - Intronic
1064735104 10:18374219-18374241 CCCTGTTCTGGAAACTTCAGAGG - Intronic
1064745730 10:18476422-18476444 CCCGGTTACAGAATTTTGTGGGG + Intronic
1065153578 10:22847350-22847372 CCCCATTACAGAATTTTCTGGGG + Intergenic
1067029517 10:42870986-42871008 CTCTGTGTTGGGATTTTCTGTGG + Intergenic
1072213561 10:93268988-93269010 CCCTGTTACAGAATTTTCTGGGG + Intergenic
1072503292 10:96040681-96040703 TCCTGTTATGGAATGTTCGCCGG + Intergenic
1074343030 10:112653040-112653062 CCCCATTACAGAATTTTCTGGGG + Intronic
1075190095 10:120299351-120299373 TCCTGTTACAGAATTTTCTGGGG - Intergenic
1075506214 10:123024778-123024800 CCCAGTTACAGAATTTTCTGGGG + Intronic
1076277243 10:129212057-129212079 CCTTGTTCTGTTATTTTCTGGGG - Intergenic
1079742147 11:24076187-24076209 CCCAGTTACAGAATTTTCTGGGG + Intergenic
1079988087 11:27219022-27219044 CCCTGTTACAGAATTTTCTGGGG - Intergenic
1080139185 11:28894665-28894687 CCCTGTTACTGCATTTTCAGGGG - Intergenic
1080464387 11:32483215-32483237 CCCTGTGAAGGTATTTTTTGAGG - Intergenic
1081722784 11:45302327-45302349 CCCTGTTATAAAATTTTCTGGGG + Intergenic
1082205274 11:49425900-49425922 TCCTGTTATTGATTTTTGTGAGG + Intergenic
1082778555 11:57268038-57268060 CCCAGTTACAGAATTTTCTGGGG - Intergenic
1084456256 11:69269825-69269847 CACTCTTCTGGAAGTTTCTGGGG - Intergenic
1086572475 11:88301400-88301422 CCTGGTTACAGAATTTTCTGGGG - Intronic
1086649827 11:89274636-89274658 TCCTGTTATTGATTTTTGTGAGG - Intronic
1087520828 11:99233306-99233328 CCTTGTTATGGGATTTTCACTGG - Intronic
1088295265 11:108286459-108286481 CCTGGTTACAGAATTTTCTGGGG + Intronic
1088304476 11:108393536-108393558 CTATGTGATGGAATCTTCTGGGG + Intronic
1088714807 11:112539602-112539624 CCCCGTTATGGATTTTTTGGGGG + Intergenic
1090553584 11:127849791-127849813 CCCACTTAGGGATTTTTCTGGGG - Intergenic
1090665313 11:128911337-128911359 GCCTGTTTTGGAATCTTCTTGGG - Exonic
1090894079 11:130953944-130953966 CACTTTAATGGAATTTTCCGTGG - Intergenic
1092655297 12:10677710-10677732 CCTGGTTACAGAATTTTCTGGGG + Intergenic
1092901948 12:13068089-13068111 AACTTGTATGGAATTTTCTGGGG + Intronic
1093653369 12:21669333-21669355 ACCTGGTAAAGAATTTTCTGGGG + Intronic
1094555439 12:31494839-31494861 GCCCATTATAGAATTTTCTGAGG - Intronic
1094713989 12:32993855-32993877 CCCTGATATGGAATGGTCAGTGG + Intergenic
1095180071 12:39137372-39137394 CCCATTTACAGAATTTTCTGGGG + Intergenic
1095195816 12:39315361-39315383 TCATTTTATGGATTTTTCTGGGG - Intronic
1095921485 12:47535891-47535913 CCCTTTACTGGAATTTTCTGAGG - Intergenic
1096143569 12:49262940-49262962 CCCTCTGCTGGAATTTTTTGGGG - Intronic
1096970941 12:55665830-55665852 CCCCGTTACAGAATTTTCTGGGG + Intergenic
1097500592 12:60395765-60395787 CTCTGTTATGGATTCTTTTGGGG + Intergenic
1097663972 12:62459890-62459912 CCCGCTTACAGAATTTTCTGGGG + Intergenic
1098087428 12:66862133-66862155 TCCTGTTAAGCAATTTTCTATGG + Intergenic
1098313274 12:69168668-69168690 CCCAGTTACAGAATTTTCTGGGG - Intergenic
1098313351 12:69169377-69169399 CCCAGTTACAGAATTTTCTGGGG - Intergenic
1099935376 12:89118921-89118943 CCATGTTATAGAATTTTGTGAGG - Intergenic
1103924450 12:124415804-124415826 CCCTGCTATGGAACATTCTAGGG + Intronic
1104279433 12:127360900-127360922 CCTGGTTACAGAATTTTCTGGGG - Intergenic
1104314531 12:127684713-127684735 TCCTAGTTTGGAATTTTCTGTGG + Intergenic
1106601589 13:31192176-31192198 CCCAGTTCCAGAATTTTCTGGGG - Intergenic
1106841033 13:33685272-33685294 CCCCGTTACAGAATTTTCTGGGG - Intergenic
1107593517 13:41935888-41935910 CCACATTATGGAATCTTCTGTGG - Intronic
1108389446 13:49933942-49933964 TCCTCTTTTGGAATTTTCTATGG - Intronic
1108705257 13:52979701-52979723 TCCAGTTAAGGAAATTTCTGAGG - Intergenic
1109654256 13:65368689-65368711 GCCAGTTACAGAATTTTCTGGGG - Intergenic
1109696769 13:65971395-65971417 CCCTGTTATGGCATTTTGTATGG + Intergenic
1110574015 13:77035862-77035884 CCCGGTTACATAATTTTCTGGGG + Intergenic
1110938045 13:81317588-81317610 CCGGGTTATGGATTTCTCTGTGG - Intergenic
1112404285 13:99104498-99104520 CCCCTTTACAGAATTTTCTGGGG + Intergenic
1113248898 13:108429283-108429305 TCCTGATGTTGAATTTTCTGTGG - Intergenic
1114542792 14:23474900-23474922 CCCTGTTATAGTCTTTTTTGGGG + Intronic
1115501873 14:34057356-34057378 CCCTGTTAGGGAAATGTCAGGGG + Intronic
1117816609 14:59605524-59605546 CCCTCTGACGGAATTTTCTGTGG - Intronic
1121651649 14:95563230-95563252 CCCTGTTACAGAATCTTCTGAGG - Intergenic
1121653503 14:95577045-95577067 CCTGGTTACAGAATTTTCTGGGG + Intergenic
1123038108 14:105479463-105479485 CCCTGCTATGGAATCCTCTTCGG + Exonic
1123821204 15:24031939-24031961 CCTGGTTACAGAATTTTCTGGGG + Intergenic
1124861974 15:33450577-33450599 CTCTGTTCTTGAATTTTTTGAGG + Intronic
1126194378 15:45915868-45915890 CCCTGGAATTGAATATTCTGTGG + Intergenic
1126995386 15:54437206-54437228 TCCTCTTTTGGAACTTTCTGGGG - Intronic
1127962804 15:63902309-63902331 GACTGTTATGGAATCTTCAGAGG + Intergenic
1128564129 15:68688671-68688693 CCATATAATGGAATATTCTGAGG - Intronic
1128990710 15:72257516-72257538 CCCTGTTTTAGAGTTGTCTGAGG - Intronic
1130049896 15:80475203-80475225 ACCTGTCATTGAGTTTTCTGAGG - Exonic
1130312006 15:82764377-82764399 CCGGGTTACAGAATTTTCTGGGG - Intronic
1130926222 15:88387883-88387905 GCCTGTTATGGGATGTGCTGAGG - Intergenic
1132172816 15:99679634-99679656 CCCAATTATGGAAACTTCTGGGG + Intronic
1132278564 15:100592137-100592159 CCCCGTTACAGAATTTTCTGAGG - Intronic
1132857573 16:2053677-2053699 TCCTCTTATGGGATGTTCTGGGG + Intronic
1133099041 16:3467955-3467977 CCTGGTTACAGAATTTTCTGGGG + Intronic
1133658504 16:7890932-7890954 CCCAGTTACAGAATTTTCTGGGG + Intergenic
1134280415 16:12812035-12812057 CCCAGTTACAGAATTTTCTGGGG + Intergenic
1135788682 16:25373673-25373695 CCCCATTACAGAATTTTCTGGGG + Intergenic
1136065466 16:27755384-27755406 CCCTGAGATGGAGTTTCCTGGGG + Intronic
1136289038 16:29260592-29260614 CCGTGTTCTGGAGGTTTCTGCGG + Intergenic
1136401982 16:30024200-30024222 CCCCTTTCTGGAAGTTTCTGTGG - Exonic
1137283009 16:46993867-46993889 CCCAGTTACAGAGTTTTCTGAGG - Intergenic
1137393724 16:48102344-48102366 CTCAGTTACAGAATTTTCTGGGG - Intronic
1137845262 16:51681533-51681555 CCTGGTTACAGAATTTTCTGGGG - Intergenic
1137962447 16:52896489-52896511 TCCTGTTATGGAATATACTTTGG + Intergenic
1138386944 16:56642292-56642314 CCTGGTTATAGAATTTTCTATGG + Intronic
1138406693 16:56801026-56801048 CACTGTTTTGTCATTTTCTGTGG + Intronic
1138881720 16:61024265-61024287 CTCTGTCATGGCATTTACTGTGG - Intergenic
1139283599 16:65790712-65790734 CCCTGGAATGGGATTTTTTGGGG - Intergenic
1140115027 16:72034496-72034518 CCCCATTATAGAATTTTCTGGGG - Intergenic
1140830213 16:78743882-78743904 CCTGGTTAAAGAATTTTCTGGGG - Intronic
1142094770 16:88233519-88233541 CCGTGTTCTGGAGGTTTCTGCGG + Intergenic
1143437551 17:6940408-6940430 GCCTGTTACTGAATTTTCTGAGG + Intronic
1144306041 17:13970386-13970408 CCCGGTTACAGAATCTTCTGGGG - Intergenic
1146443517 17:32917452-32917474 CCCCATTACAGAATTTTCTGGGG - Intergenic
1146444974 17:32926518-32926540 CCCTGCTGTAGAATCTTCTGGGG - Intergenic
1146755976 17:35432374-35432396 CCCGGTTTCAGAATTTTCTGGGG + Intronic
1147721550 17:42542855-42542877 CCCTGTCCTGGAGTTTTCAGAGG + Intronic
1148584502 17:48767869-48767891 CCCTGTAATGGAGTGTGCTGAGG - Intronic
1149342763 17:55703523-55703545 CCCTGTTATGTTATTTTTGGTGG + Intergenic
1149415787 17:56458788-56458810 TCCTGTTATGCATATTTCTGGGG - Intronic
1149476243 17:56963412-56963434 CCCTGTTACAGAATTTTTGGGGG - Intergenic
1151797682 17:76357367-76357389 CCCCGTTACAGAATTTTCTGGGG - Intronic
1153261726 18:3230726-3230748 CCCAGTTACGGAATTTTCCGGGG - Intergenic
1153378218 18:4405984-4406006 CCTGGTTATGGAATTTTCTGGGG + Intronic
1153832158 18:8933422-8933444 CCTGGTTACGGAATTTTCTTGGG - Intergenic
1155288661 18:24318927-24318949 CTCTGGTAGGTAATTTTCTGGGG - Intronic
1156238384 18:35227236-35227258 CCCAGTTAAATAATTTTCTGGGG + Intergenic
1157164703 18:45347793-45347815 GCCTGTTCTGGAAGTGTCTGTGG - Intronic
1158093895 18:53748225-53748247 ACCTGTTGTGGAATTTTTTTTGG - Intergenic
1158597420 18:58828274-58828296 CCCCTTTACAGAATTTTCTGGGG - Intergenic
1158625974 18:59071952-59071974 CCCCTTTACAGAATTTTCTGGGG - Intergenic
1158847653 18:61461749-61461771 CCCTGTTACAGAATTTTCTGGGG + Intronic
1159476951 18:68933861-68933883 CGTTGTTATGGATTTTTCTTTGG - Intronic
1159793180 18:72809806-72809828 CTATGTTAGGAAATTTTCTGAGG - Intronic
1159845873 18:73459417-73459439 GCGTGTTATGTATTTTTCTGGGG - Intergenic
1160294071 18:77622003-77622025 CCAAGTTACAGAATTTTCTGGGG + Intergenic
1161257020 19:3315201-3315223 GCCTGTGATGGGATGTTCTGAGG + Intergenic
1162675142 19:12293350-12293372 CTGTGTTATGGAACTTTCTGGGG - Exonic
1163590613 19:18192107-18192129 ACCTGTTTAAGAATTTTCTGGGG - Intergenic
1165059808 19:33199642-33199664 CCCTGATGTGGAAATTTCCGGGG + Intronic
1165255384 19:34574701-34574723 CCAGGTTACAGAATTTTCTGGGG + Intergenic
1167053292 19:47093251-47093273 TTCTCTTATGGGATTTTCTGGGG + Intronic
1168682476 19:58326284-58326306 CCCGGTTACAGAATTTTCTGGGG + Intergenic
925438599 2:3864224-3864246 CCCTGTTCTCAAATTTTGTGTGG + Intergenic
925813017 2:7719734-7719756 CCCTGTTATAGAATGTTCTGGGG - Intergenic
926473156 2:13286714-13286736 TCCTGTTATGGGATTTGGTGTGG - Intergenic
927816350 2:26220974-26220996 CCATGTTAGTGAAATTTCTGGGG + Intronic
928810758 2:35222030-35222052 CCCTTTGATGGAAAATTCTGTGG + Intergenic
928965197 2:36968760-36968782 TCCCGTTACAGAATTTTCTGGGG - Intronic
930142386 2:47965404-47965426 ACTGGTTATAGAATTTTCTGGGG - Intergenic
930496026 2:52144773-52144795 CCCAGTCACAGAATTTTCTGGGG - Intergenic
931274488 2:60732708-60732730 CCTCGTTACAGAATTTTCTGGGG + Intergenic
931342461 2:61414742-61414764 CCCAGTTACAGAATTTTCTGGGG + Intronic
931802928 2:65776400-65776422 CCATGCTGGGGAATTTTCTGGGG + Intergenic
932327892 2:70875458-70875480 GCCTGTTATGGCATTATTTGAGG + Intergenic
932823554 2:74921138-74921160 TCTTGTTATGGGTTTTTCTGGGG + Intergenic
933651733 2:84855311-84855333 CCCTGATATGGCATTTCCTACGG + Intronic
935309249 2:101766947-101766969 CCTGGTTACAGAATTTTCTGGGG + Intronic
937140727 2:119597715-119597737 CTCTGTTATAGAATTTTCTGGGG + Intronic
937289662 2:120774631-120774653 CCCTGTTCTTGACTTTTTTGAGG + Intronic
938236199 2:129708953-129708975 CCCCGTTACAGAATTTTCTGGGG + Intergenic
938802918 2:134779276-134779298 GCCGGTTATAGAATCTTCTGGGG + Intergenic
940772061 2:157850008-157850030 CCAAGTTTTGGAATTTTCTGAGG - Intronic
941144973 2:161833339-161833361 CCCTTTTATGGAGATTTCTCTGG + Intronic
941694543 2:168536631-168536653 CCAGGATATGTAATTTTCTGTGG + Intronic
941708564 2:168686995-168687017 CCCTGAAATGGAAGTTTCTATGG - Intronic
942235265 2:173897926-173897948 CCCTGTTTTGGAACTTTCACAGG - Intergenic
942390776 2:175490811-175490833 CCCTAATATGGGATTTTATGTGG + Intergenic
942422202 2:175819886-175819908 CCTGGTCATGGATTTTTCTGGGG + Intergenic
942917899 2:181334524-181334546 CCCTGTTACAGAAGTTTTTGAGG + Intergenic
943743555 2:191437517-191437539 CCCTGTTACAGAATTTTCTGGGG + Intergenic
943805328 2:192117872-192117894 ACTGGTTATAGAATTTTCTGGGG - Intronic
945063805 2:205931432-205931454 CCCAGTTACAGAATTTTCTAGGG + Intergenic
946175541 2:217919945-217919967 CCCTTTTATGGGTTTTTCTAAGG + Intronic
946908068 2:224435022-224435044 CCTGGTTACAGAATTTTCTGGGG - Intergenic
946929753 2:224659979-224660001 CCTCGTTACAGAATTTTCTGGGG - Intergenic
947497813 2:230651422-230651444 CCCCGTTACAGAATTTTCTGGGG + Intergenic
947498284 2:230654577-230654599 CCCAGTTACAGAATTTTCTGGGG + Intergenic
948023050 2:234753029-234753051 CCCAGATACAGAATTTTCTGGGG + Intergenic
948075440 2:235162140-235162162 CTCAGTTACAGAATTTTCTGGGG + Intergenic
948154872 2:235773164-235773186 CCCAGTAACAGAATTTTCTGGGG + Intronic
948272324 2:236684010-236684032 CCCTGTTACAGAATTTTTGGGGG + Intergenic
1169081004 20:2797752-2797774 CCCTGTGGTGGCATTATCTGGGG + Intronic
1169789253 20:9392324-9392346 CCCTGTTACAGAATTTTCTGGGG + Intronic
1172620520 20:36315737-36315759 CCCTGCTCTGGAACCTTCTGTGG - Intronic
1172636633 20:36414416-36414438 CCCTGGTATGGACATTCCTGGGG - Intronic
1172739452 20:37154278-37154300 TCCTCTTCTGGATTTTTCTGAGG - Intronic
1173288523 20:41693988-41694010 CGCTGTTATAGAATTTTCTGGGG + Intergenic
1174857894 20:54064277-54064299 CCCTGTTTTGGATATTTCTGGGG + Intronic
1175057427 20:56210933-56210955 CCCCGTTACAGAATTTTTTGGGG + Intergenic
1177850867 21:26346960-26346982 CCCATTTATGGAAGTTCCTGTGG + Intergenic
1178039820 21:28627985-28628007 CCCTGTTACAGAATTTTCTGGGG - Intergenic
1179711453 21:43265800-43265822 CCCTCTTCTGGAATTTTCAGAGG - Intergenic
1180411986 22:12621607-12621629 CCCTAAAATGGAATTTTATGTGG - Intergenic
1180443593 22:15391392-15391414 CACTGTTCTGGAATCTTATGCGG + Intergenic
1181437709 22:22920143-22920165 CTCTGTTCTGGAATATTCTCTGG - Intergenic
1181666021 22:24397996-24398018 CCCTGTGACAGAATTTTCTGTGG + Intronic
1182400412 22:30071878-30071900 TCCTGATAAGGAATTTTCTTAGG - Intergenic
1184333943 22:43842197-43842219 CCCTGTTATGGAAGTGGCTCAGG + Intronic
1184475922 22:44721265-44721287 CCAGGTTACAGAATTTTCTGGGG + Intronic
950642841 3:14359698-14359720 CCCTGTTCTTGAAGGTTCTGTGG - Intergenic
950905571 3:16534799-16534821 GCCTGTTATAGAACTTTATGTGG + Intergenic
951188430 3:19741250-19741272 CCTGGTTATAGAATTTTCTGAGG - Intergenic
951857388 3:27213090-27213112 CCCTGTTACAGGATTTTCTGGGG - Intronic
952321333 3:32280562-32280584 GCTGGTTATGGAATTTTCTGGGG - Intronic
954887915 3:53892837-53892859 TCCTATTATGAACTTTTCTGGGG - Intergenic
955399984 3:58584837-58584859 CCCCGTTACGGAATTTTCTGGGG - Intronic
957422613 3:79991159-79991181 CCGTGTTATAGAATTTTCTGGGG + Intergenic
957718790 3:83968536-83968558 CCCAGTTACAGAATTTTCTGGGG - Intergenic
958289326 3:91800845-91800867 CACTTTTGTGGAATTTTCAGGGG + Intergenic
958327436 3:92424984-92425006 CACTTTTGTGGAATTTTCAGGGG + Intergenic
958377821 3:93250409-93250431 CACTTTTGTGGAATTTTCAGGGG + Intergenic
958383689 3:93346183-93346205 CACTTTTGTGGAATTTTCAGGGG + Intergenic
958392397 3:93488623-93488645 CACTTTTGTGGAATTTTCAGGGG + Intergenic
958394681 3:93526205-93526227 ACTTGTTGTGGAATTTTCAGGGG + Intergenic
958510997 3:95048657-95048679 CTCAGTTATGGAAGTCTCTGTGG + Intergenic
958627970 3:96650637-96650659 CCCCGTTACAGAATTTTCTGGGG + Intergenic
959222268 3:103535576-103535598 GCCTGTTACAGAATTTTCTGAGG - Intergenic
959596668 3:108136492-108136514 CCCAGTTACAGAACTTTCTGGGG + Intergenic
961500198 3:127326891-127326913 CACTGTCATGGAATTGGCTGGGG + Intergenic
961776838 3:129293268-129293290 CACTGATAGGGAATTATCTGAGG - Intronic
962098231 3:132314571-132314593 ACCTGTTTTAGAATGTTCTGTGG - Intergenic
962245533 3:133788375-133788397 CCCAGTTACAGAATTTTCTCGGG - Intronic
962246273 3:133796536-133796558 CCCGGTTACAGAATTTTCTGGGG - Intronic
963014273 3:140806292-140806314 CCCACTTACAGAATTTTCTGGGG - Intergenic
963719553 3:148845444-148845466 CCCTGTGATGAAACTTACTGTGG + Exonic
964048645 3:152363275-152363297 AGCTGTTATGGGATTTTATGTGG + Intronic
964300712 3:155282310-155282332 CCTGGTTACAGAATTTTCTGGGG - Intergenic
964749595 3:160042167-160042189 ACCAGTTACAGAATTTTCTGGGG + Intergenic
965306988 3:167078149-167078171 CCTGGTTACAGAATTTTCTGGGG + Intergenic
965902193 3:173655994-173656016 CCCTGTTAAAGAATTTTTTGGGG + Intronic
966993294 3:185255437-185255459 CCTTGTTACAGAATTTTCTGGGG + Intronic
967588151 3:191239242-191239264 CCCTGTTATGGAATTTTGAGGGG + Intronic
971319028 4:25590507-25590529 CCCGGTTACAGAATTTTCTGGGG - Intergenic
971410723 4:26368774-26368796 CTTTGTTGTTGAATTTTCTGTGG + Intronic
971779937 4:31020202-31020224 ACCTGTGTTGGGATTTTCTGAGG - Intronic
972100173 4:35406002-35406024 CCCTATAATGAATTTTTCTGGGG + Intergenic
972116541 4:35642663-35642685 TCCTGATACAGAATTTTCTGGGG + Intergenic
972238141 4:37158105-37158127 CCCAGTTACATAATTTTCTGGGG - Intergenic
973335486 4:48951634-48951656 CCTTGTTACAGAATTTTTTGCGG + Intergenic
974022620 4:56705324-56705346 CCCGGTTACAGAATTTTCTGGGG + Intergenic
974399147 4:61378631-61378653 CGCTGTTATGGAATTCTATTTGG + Intronic
974479816 4:62428557-62428579 CCCAGTTACAGAATTTTCTGGGG + Intergenic
974941145 4:68469808-68469830 CTGAGTTAGGGAATTTTCTGTGG - Intronic
975328988 4:73092171-73092193 CCCTATTTTGGAATTTGCTGAGG + Exonic
975967681 4:79994538-79994560 CACTGTTATATAAATTTCTGAGG + Intronic
976043528 4:80916677-80916699 CAATGTTATGGAATCTGCTGTGG - Intronic
976437266 4:85032552-85032574 CCTGGTTACAGAATTTTCTGAGG + Intergenic
976814657 4:89133670-89133692 CCTGGTTACAGAATTTTCTGGGG + Intergenic
976933131 4:90593451-90593473 CCCTGTTACAGAATTTTTGGGGG + Intronic
977679279 4:99781124-99781146 CCCTTTAATGGCATATTCTGAGG - Intergenic
978396378 4:108284987-108285009 GCCGGTTACAGAATTTTCTGGGG + Intergenic
979156740 4:117401744-117401766 TCTAGTTATGGAATTTTCTTTGG - Intergenic
979544407 4:121923265-121923287 ACCTGTTAAGGGAGTTTCTGTGG - Intronic
981592831 4:146383506-146383528 CCTGGTTACAGAATTTTCTGGGG - Intronic
981696644 4:147565411-147565433 CCCAGTTACAGAATTTTCCGGGG + Intergenic
981974759 4:150712577-150712599 ACAAGTTAAGGAATTTTCTGAGG - Intronic
981989650 4:150902614-150902636 CCCTGTTACAGAATTTTCTGGGG - Intronic
982222780 4:153139276-153139298 CCGGGGTATGGAATCTTCTGGGG - Intergenic
982277973 4:153656247-153656269 CCCAGTTACGCAAGTTTCTGAGG + Intergenic
983506073 4:168555333-168555355 ACCTGGTATGGATTTTTCTCAGG - Intronic
984789831 4:183605338-183605360 TCCTGTTACAGAATTTTCTGGGG - Intergenic
984921423 4:184767441-184767463 CTCTATTCTGGACTTTTCTGTGG - Intronic
985438399 4:189958152-189958174 CCCTGAAATGGAATATTATGTGG - Intronic
985767855 5:1789687-1789709 CCCAGTTACAGAATTTTCTGGGG - Intergenic
985777169 5:1850909-1850931 GCCTGTTCTGGAATTTTCTGTGG + Intergenic
986254314 5:6089022-6089044 ACCGGTTACAGAATTTTCTGGGG - Intergenic
986369834 5:7068851-7068873 CCCAGTTACAGAATTTTCTGGGG + Intergenic
986759526 5:10867729-10867751 CCCAGTTACAGAATTTTCTGGGG - Intergenic
986809002 5:11336100-11336122 CCCAGTTCCAGAATTTTCTGGGG - Intronic
987270222 5:16300335-16300357 CCATGTAATAGAATTGTCTGGGG - Intergenic
988599173 5:32623645-32623667 CCCCATTACAGAATTTTCTGGGG - Intergenic
988999579 5:36745896-36745918 GCCTGTTCTGCAATTTTCTAAGG - Intergenic
989412707 5:41139094-41139116 CCCCATTACAGAATTTTCTGGGG + Intergenic
990624947 5:57600201-57600223 ACTTGTCATGGAATTGTCTGTGG - Intergenic
991140156 5:63231448-63231470 CCCTGATATGTAATTTTAGGAGG + Intergenic
991510348 5:67369690-67369712 CACTGTTTAGGAATTTTGTGAGG + Intergenic
991686237 5:69184954-69184976 CCAGGTTACAGAATTTTCTGGGG - Intergenic
991723908 5:69517138-69517160 CCCTGTGATGTCAGTTTCTGAGG - Intronic
994141917 5:96350957-96350979 CCATGTCATGCATTTTTCTGTGG + Intergenic
994188655 5:96843199-96843221 CCTAGTTACAGAATTTTCTGGGG + Intronic
994218585 5:97167609-97167631 CTCTGTAACTGAATTTTCTGAGG - Exonic
994563701 5:101412489-101412511 CCATCCTATGGAATATTCTGAGG - Intergenic
996109620 5:119549944-119549966 CCCTTTTACAGAATTTTCTGGGG - Intronic
996712939 5:126561775-126561797 CTCTGTTATTTAATTTTTTGGGG - Intronic
996853263 5:127976591-127976613 CCCAGTTACAGAATTTTCTGGGG + Intergenic
998472824 5:142396630-142396652 CCTGGTTACAGAATTTTCTGGGG + Intergenic
999397949 5:151242414-151242436 CCCGGTTACAGAATTTTCTGGGG + Intronic
999398335 5:151245177-151245199 CCCTGATACAGAATCTTCTGGGG + Intronic
999526733 5:152414474-152414496 CCCAGTTACAGAATTTTCTGGGG - Intronic
1000556196 5:162729158-162729180 CCAGGTTACAGAATTTTCTGGGG + Intergenic
1000740278 5:164960543-164960565 CCCAGTTACAGAATTTTCTGGGG + Intergenic
1002015420 5:176317979-176318001 CCTGGTTACAGAATTTTCTGGGG + Intronic
1003348061 6:5289448-5289470 CCCAGTTACAGAATTTTCTGGGG + Intronic
1008220328 6:48846263-48846285 CCTGGTTACAGAATTTTCTGGGG + Intergenic
1008480200 6:51978059-51978081 CTCTCTTATGGGATTTTCTGTGG - Intronic
1009043970 6:58215387-58215409 CTCAGTTATTGAACTTTCTGAGG + Intergenic
1009219800 6:60969647-60969669 CTCAGTTATTGAACTTTCTGAGG + Intergenic
1010691499 6:78916073-78916095 CCCAGTTACAGAATTTTCTGGGG + Intronic
1012623535 6:101378256-101378278 TCCTATTCTTGAATTTTCTGAGG - Intergenic
1012712925 6:102631653-102631675 ACTTGTTACAGAATTTTCTGGGG - Intergenic
1013534673 6:111052958-111052980 CCCAGCTACAGAATTTTCTGGGG + Intergenic
1015105716 6:129533618-129533640 GCCTATTACAGAATTTTCTGGGG - Intergenic
1015244661 6:131062962-131062984 CCCGGCTTTGGGATTTTCTGCGG - Intronic
1015547770 6:134379061-134379083 GCTTGTTACAGAATTTTCTGGGG + Intergenic
1015821050 6:137260597-137260619 CCCCGTTACAGAATATTCTGGGG - Intergenic
1016275114 6:142340877-142340899 CCCTGTTACATCATTTTCTGTGG + Intronic
1017041579 6:150312726-150312748 CCTGGTTACAGAATTTTCTGGGG - Intergenic
1018455615 6:163949314-163949336 CATAGTTATGGAATTTCCTGAGG + Intergenic
1020908981 7:14104577-14104599 CCTGGCTATAGAATTTTCTGGGG + Intergenic
1021028281 7:15696792-15696814 ACCGGTTACAGAATTTTCTGGGG - Intergenic
1021236879 7:18153333-18153355 CCCTGTTATGGAATTTTCTGGGG + Intronic
1021699806 7:23306910-23306932 CCCTGTTCTTCAATTTTTTGGGG + Intronic
1021790468 7:24199634-24199656 CCATGCTGTGGAGTTTTCTGGGG - Intergenic
1021867563 7:24973479-24973501 CCCTGAAATTGAATTTTCTCTGG - Intronic
1024060287 7:45692409-45692431 CACTGTACTGAAATTTTCTGTGG - Intronic
1024191890 7:47020496-47020518 CCCGCTTACAGAATTTTCTGGGG + Intergenic
1024630366 7:51242298-51242320 CCTGGTTACAGAATTTTCTGGGG - Intronic
1024752380 7:52482844-52482866 CTCAGTTAGAGAATTTTCTGGGG + Intergenic
1025042377 7:55658429-55658451 CCCTGTTTTGAAGTTTTATGTGG - Intergenic
1026620969 7:71949696-71949718 CCCTGTTACAGAATTTTTTGGGG - Intronic
1027004944 7:74684951-74684973 CCCCTTTACAGAATTTTCTGGGG + Intronic
1030252656 7:107464441-107464463 GCCTGTTAATGAATTTTTTGAGG - Intronic
1030714539 7:112792039-112792061 CCGGGTTATAGAATTTTCTGGGG - Intergenic
1031298333 7:120033508-120033530 CCTAGTTACAGAATTTTCTGGGG - Intergenic
1031749267 7:125550644-125550666 GCCAGTTACAGAATTTTCTGGGG + Intergenic
1032870633 7:135980768-135980790 CCTGGTTACAGAATTTTCTGGGG + Intergenic
1033072201 7:138214399-138214421 CCCAGTTACAGAATTCTCTGGGG + Intergenic
1033073096 7:138222345-138222367 CCCAGTTACAGAATTCTCTGGGG + Intergenic
1033552190 7:142457673-142457695 CCCTGTTATGCCATTTCTTGTGG + Intergenic
1033556734 7:142494715-142494737 CCCTGTTATGCCATTTCTTGTGG + Intergenic
1033881810 7:145893588-145893610 CCATGCTATGGGATTTTGTGAGG + Intergenic
1037137151 8:15476735-15476757 CCTGGTTACAGAATTTTCTGGGG + Intronic
1037532544 8:19791633-19791655 CCTGGTTACAGAATTTTCTGGGG - Intergenic
1038142654 8:24863684-24863706 CCCCATTACAGAATTTTCTGGGG + Intergenic
1042762773 8:72288570-72288592 TCCTGGTATGGTATTTGCTGTGG - Intergenic
1045545281 8:103122903-103122925 CCCTGTTACAGAATTTTCTGGGG - Intergenic
1045971756 8:108086271-108086293 CCCTGTTATGGTGTTTTGTAAGG - Intergenic
1046383629 8:113481054-113481076 CCCAGTTACAGAATTTTCTGGGG + Intergenic
1046773213 8:118137109-118137131 CCCAGTTACAGAATCTTCTGGGG + Intergenic
1047073924 8:121378555-121378577 CCCGGTTACAGAATTTCCTGGGG - Intergenic
1047799424 8:128293432-128293454 CCCTGTGATGCAATAGTCTGAGG + Intergenic
1048613005 8:136044123-136044145 CCATCTCATGGAGTTTTCTGAGG + Intergenic
1048727419 8:137401993-137402015 CATAGTTATGGAATTCTCTGAGG + Intergenic
1048888154 8:138925082-138925104 CCCAGTTACACAATTTTCTGAGG - Intergenic
1049902847 9:186666-186688 CCATGTTAGGTATTTTTCTGTGG + Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1051072647 9:13190897-13190919 CCATCTCATAGAATTTTCTGAGG + Intronic
1051349248 9:16183609-16183631 CCCTGTTAGGCCATTTTCAGAGG + Intergenic
1051913995 9:22185773-22185795 CCCTGGGATGGAACTTTCAGAGG + Intergenic
1055668537 9:78576284-78576306 CCCAGTTACAGAATTTTCTGGGG - Intergenic
1056394155 9:86166324-86166346 CCCCATTACAGAATTTTCTGGGG - Intergenic
1058020680 9:100084037-100084059 CCCTGTTAGGCTATTTTCTCTGG - Intronic
1060489079 9:124068735-124068757 CTGTGCTATGGGATTTTCTGGGG - Intergenic
1202803538 9_KI270720v1_random:25425-25447 CCCTAAAATGGAATTTTATGTGG + Intergenic
1186130293 X:6458524-6458546 AATTGTTATGGAATCTTCTGGGG + Intergenic
1186831600 X:13395957-13395979 CCCAGTTACAGAATTTTCTGGGG + Intergenic
1187326340 X:18294442-18294464 GCCTGTGATGGGTTTTTCTGTGG - Intronic
1188518286 X:31010831-31010853 CCCAGTTACAGAATTTTCTGGGG + Intergenic
1189440727 X:41033301-41033323 CCCAGTTGCAGAATTTTCTGGGG + Intergenic
1189733084 X:44042123-44042145 GACTGTTATGGAATTATTTGGGG - Intergenic
1189761745 X:44328891-44328913 CCCCTTTACAGAATTTTCTGGGG - Intronic
1190408459 X:50111122-50111144 CCCCGGTACAGAATTTTCTGGGG + Intergenic
1190702157 X:52997129-52997151 CTCTGACATGGATTTTTCTGGGG - Intergenic
1191190992 X:57667072-57667094 TCCAGTTATGGAATTTTGGGGGG + Intergenic
1192065471 X:67880318-67880340 CCCAGTTACAGAATTTTCTGGGG - Intergenic
1192121588 X:68461297-68461319 CCCGGTTACAGAATTTTCTGGGG + Intergenic
1192566560 X:72169019-72169041 CCCAGTTACAGAATCTTCTGGGG + Intergenic
1192607655 X:72536070-72536092 CCTTGTTATGATATCTTCTGTGG + Intronic
1192930383 X:75800277-75800299 CCATATTATGGAATTTTCAGTGG - Intergenic
1193459951 X:81778117-81778139 CACTGTTTTGCAATTTTCTATGG + Intergenic
1194135639 X:90137725-90137747 CACTGTTACAGAATTTTCTGGGG - Intergenic
1195523488 X:105858206-105858228 CCATCTGATGGGATTTTCTGGGG + Intronic
1196072620 X:111543276-111543298 CCCCGTTACAGAGTTTTCTGAGG + Intergenic
1196630057 X:117927610-117927632 CCATGGTATGGAACTTTGTGAGG - Intronic
1198092545 X:133345983-133346005 CCCAGTTACAGAATCTTCTGGGG + Intronic
1199398264 X:147366366-147366388 CCCAGTTACAGAATTTTCTAGGG + Intergenic
1200481405 Y:3707806-3707828 CACTGTTACAGAATTTTCTGGGG - Intergenic
1200924303 Y:8640775-8640797 CCCTGTTTTTTATTTTTCTGTGG + Intergenic
1202178093 Y:22116037-22116059 CCCTGTTCTTTATTTTTCTGTGG - Intergenic
1202178379 Y:22118452-22118474 CCATGTTATTTATTTTTCTGTGG - Intergenic
1202212982 Y:22467942-22467964 CCATGTTATTTATTTTTCTGTGG + Intergenic
1202213268 Y:22470358-22470380 CCCTGTTCTTTATTTTTCTGTGG + Intergenic