ID: 1021237997

View in Genome Browser
Species Human (GRCh38)
Location 7:18166813-18166835
Sequence ATTTGTTTGTAGCTTTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021237997_1021237999 -4 Left 1021237997 7:18166813-18166835 CCAGGACAAAGCTACAAACAAAT 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1021237999 7:18166832-18166854 AAATATCATAATGTCCAAGTGGG No data
1021237997_1021237998 -5 Left 1021237997 7:18166813-18166835 CCAGGACAAAGCTACAAACAAAT 0: 1
1: 0
2: 1
3: 19
4: 188
Right 1021237998 7:18166831-18166853 CAAATATCATAATGTCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021237997 Original CRISPR ATTTGTTTGTAGCTTTGTCC TGG (reversed) Intronic
900294331 1:1941314-1941336 ATTTGTCTGGACCTTGGTCCCGG + Intronic
900756895 1:4442031-4442053 ATTTGTATTCAGCTTTGTGCTGG - Intergenic
904345769 1:29867982-29868004 ATTTTTTTGTAGCTTAGTCCTGG + Intergenic
906357993 1:45124958-45124980 ATTTGTCTGTATCTTTTTTCAGG - Intronic
906456262 1:45999898-45999920 ATTTGTTGAAAGCTGTGTCCTGG + Intronic
907701467 1:56792246-56792268 TTTTGTTTCCAGCTTTTTCCTGG + Exonic
909261970 1:73501674-73501696 AGTTCCTTGCAGCTTTGTCCTGG - Intergenic
910681908 1:89875097-89875119 ATTGGTTTGTAGCTTTATACAGG - Intronic
910952869 1:92669892-92669914 ATTTGTATGTAGCTATATCTAGG - Intronic
915029814 1:152868686-152868708 ATTTGTTTCTTGCTTTGTTTTGG - Intergenic
915897494 1:159823327-159823349 ATTTGGGTGAAGCTTTGTGCTGG - Intergenic
918384629 1:183993354-183993376 ATTTGCTTGAACCTCTGTCCTGG - Intronic
918884710 1:190177115-190177137 TTTTGTTTGTTGGTTTGTCATGG + Intronic
923260392 1:232262328-232262350 ATTTTTTTGTAGCTATATGCTGG + Intergenic
1063332363 10:5173540-5173562 ATTTGTTTATAGTTATGTTCAGG - Intergenic
1064296158 10:14080611-14080633 CTGTGATTGTAGCTGTGTCCAGG - Intronic
1064575381 10:16740154-16740176 ATTAGTTTGTAGTTTTCTTCTGG - Intronic
1064775818 10:18775640-18775662 ATTTCTTTTTAACTTTGTTCTGG + Intergenic
1065992898 10:31030504-31030526 ATCTGTTTGTTGGTTTTTCCAGG - Intronic
1066494229 10:35926546-35926568 ATTGTTTTGTAGCTTTGGCAAGG + Intergenic
1067226331 10:44378635-44378657 ACTTGTTTAAAGCTTTCTCCAGG + Exonic
1069415131 10:68192721-68192743 ATTTCTTTGTAGTTTAGTCTTGG + Intronic
1076069212 10:127472912-127472934 ATTTGTTTGTAGTTTTATTCTGG + Intergenic
1079504889 11:21142450-21142472 AATTGTTGGTAGCTTTGACAAGG + Intronic
1080188063 11:29515023-29515045 ATTTGTTTGTAGCTGTGGTATGG - Intergenic
1080403624 11:31959234-31959256 ATTTGTCTGTAGATTGCTCCAGG + Intronic
1083496587 11:63059781-63059803 ATTTGTTTGTATCTCTGTTTTGG + Intergenic
1084141915 11:67237606-67237628 TTTTGTTTGTTTGTTTGTCCTGG + Intronic
1088138823 11:106591347-106591369 ATTTTGTTGTAGGTTTGTCAAGG + Intergenic
1088186274 11:107175112-107175134 ATTGGTTTGCTGCTTTCTCCCGG + Intergenic
1090247416 11:125226356-125226378 ATTTGTGTGTAAGTTTTTCCGGG - Intronic
1091565158 12:1642712-1642734 AATTGTTTGTTGTCTTGTCCGGG + Intronic
1091895085 12:4096100-4096122 ATTTGTGTGGAGCTATTTCCAGG - Intergenic
1092058529 12:5526712-5526734 ATATATTTGTAACTTTGTCATGG - Intergenic
1092396473 12:8131719-8131741 ATTTATTTGAAATTTTGTCCAGG + Intronic
1092675133 12:10908612-10908634 ATTTGTATGGACCTTGGTCCTGG + Exonic
1092702832 12:11251783-11251805 AATTTTTTGTAGCTTTGTAGAGG - Intergenic
1093297948 12:17415367-17415389 ATCTGTTGGTACCTTTGTCTTGG - Intergenic
1093901473 12:24639289-24639311 ATTTGTTTTTACCTTTCTTCGGG - Intergenic
1098221240 12:68272067-68272089 TTTTATTTATAGCTTTATCCTGG - Intergenic
1102395462 12:112581952-112581974 ATTTGTTGGTAGGTGTGTCAAGG - Intronic
1103891678 12:124243618-124243640 GTTTGTTTGTAATTTTGTCAGGG + Intronic
1103954967 12:124571036-124571058 ACTTGTTTCTAGATTTTTCCAGG - Intergenic
1104589609 12:130073920-130073942 ATTTGAATGTAGGTGTGTCCTGG + Intergenic
1105200967 13:18176810-18176832 ATTTGGATATAACTTTGTCCAGG - Intergenic
1105272390 13:18890036-18890058 ATATGTTTGTAGCTATCTCGTGG - Intergenic
1105686297 13:22785682-22785704 ATTTGATTATAGATTTTTCCTGG - Intergenic
1109294945 13:60518748-60518770 AGATGTTTGTAGCTTAGTGCTGG - Intronic
1112953002 13:105025346-105025368 ATTTTTTGGTTGCTTTGACCTGG + Intergenic
1113264277 13:108599842-108599864 CTTTCTTTGTAGCCTTGTACAGG + Intronic
1114115312 14:19616070-19616092 ATTTTTTTGTACTTTTGTCACGG + Intergenic
1114928924 14:27442877-27442899 ATATGTTTCTGGCTTTGTCAGGG - Intergenic
1116720492 14:48489743-48489765 ATTTGTTTGTTTCTTTGTTTCGG - Intergenic
1120182848 14:81363472-81363494 CTTTGTTTGAAGCTTTTTCCAGG - Intronic
1120804598 14:88733253-88733275 CTTTGTTTATGGCTTTGTCTTGG - Intronic
1123703694 15:22935275-22935297 ATCTGTCTGTGGCTCTGTCCAGG - Intronic
1123849940 15:24344135-24344157 CTTTGTTATTAGCTTTGTCCAGG + Intergenic
1123855001 15:24400399-24400421 ATTTGTTTGCAACATTGTACTGG - Intergenic
1125407488 15:39368906-39368928 CTTTGTGTGTAGCTTAGTTCTGG - Intergenic
1130637200 15:85634561-85634583 ATTTGTTTTCAGCTTTATTCTGG + Intronic
1130783535 15:87070675-87070697 ACTTGTTTGTAGCTTTTGCCTGG + Intergenic
1133842382 16:9421453-9421475 ATTTGTTTTGACCTCTGTCCAGG + Intergenic
1135421800 16:22309756-22309778 ACTTGTATGTATCTGTGTCCCGG - Intronic
1136846878 16:33583339-33583361 ATTTGTTTGTTGCTTGGTGCTGG + Intergenic
1137524588 16:49223632-49223654 ATCTGTTTGAAGCTTTGGCATGG - Intergenic
1138011284 16:53383095-53383117 ATTGGTCTGTAGCTTTGTGGGGG + Intergenic
1203108586 16_KI270728v1_random:1431994-1432016 ATTTGTTTGTTGCTTGGTGCTGG + Intergenic
1146822393 17:35994104-35994126 CTGTGCTTGTAGCTTTATCCTGG - Intronic
1149193873 17:54096149-54096171 ATTTGTTTTCACCTTTGCCCGGG + Intergenic
1150355433 17:64480379-64480401 ATTTCTTTCTAGGTTTGTCAAGG - Exonic
1151042235 17:70875850-70875872 ATTTGTTTCTTGCTTTGGACTGG - Intergenic
1153512215 18:5868522-5868544 ATTTGTTTGTTACTTTGTTTGGG - Intergenic
1153904912 18:9652531-9652553 ATTTCTTTGTAGTTTTATTCTGG + Intergenic
1164891013 19:31823478-31823500 ATTTGATTGTATCTTTGTAATGG - Intergenic
1167021989 19:46884084-46884106 ACTAGTTTTTAGCTTTGTCAAGG + Intergenic
925555271 2:5123878-5123900 ATTAGTTTGTAACATTGGCCAGG - Intergenic
926361687 2:12094077-12094099 ATTTGTGTGGAGGTGTGTCCAGG - Intergenic
928678223 2:33671438-33671460 ATTTGTTAGTAGCACTTTCCTGG + Intergenic
929096653 2:38268780-38268802 ATTTCTTTGGAACTTTTTCCTGG - Intergenic
930592175 2:53341230-53341252 ATCTGTTTGTTCCTATGTCCAGG + Intergenic
933585658 2:84177239-84177261 GACTGTTTGTAGCTTTCTCCTGG - Intergenic
933978768 2:87533569-87533591 CTTTGCTTTTAGCTTTGCCCTGG - Intergenic
934116502 2:88802045-88802067 ATTTGGATATAACTTTGTCCAGG + Intergenic
934626109 2:95854512-95854534 ATTTGGATATAACTTTGTCCAGG - Intronic
934807462 2:97246803-97246825 ATTTGGATATAACTTTGTCCAGG + Intronic
934830048 2:97510384-97510406 ATTTGGATATAACTTTGTCCAGG - Intronic
935098490 2:99969796-99969818 ATTTGTATCTAGATTTGGCCAGG - Intronic
935673729 2:105576594-105576616 CTTTGTTTGTCTCTTTGTCCTGG - Intergenic
936315062 2:111417225-111417247 CTTTGCTTTTAGCTTTGCCCTGG + Intergenic
937772435 2:125735915-125735937 ATTTGTTTTTGGCTTTCTCTTGG - Intergenic
938426266 2:131191868-131191890 ATTTTTTTGTACTTTTGTCACGG - Intronic
938536145 2:132250918-132250940 ATTTGTTACTAACTTTGTACTGG - Intronic
938994083 2:136659099-136659121 TTTTGTTTGTATCTTTTTTCAGG - Intergenic
943733161 2:191324771-191324793 AGTTATTTGTACCTTTATCCTGG - Intronic
944220824 2:197302596-197302618 ATTGGTTGGTTGATTTGTCCCGG + Intronic
944566369 2:200995613-200995635 AGTTTTTTGTAGCTGTGTGCTGG - Intronic
1169100627 20:2945356-2945378 GTTTGTTTCTAGCTTTGCCTAGG + Intronic
1169311249 20:4542155-4542177 AATTGTTTGTCTCTATGTCCAGG + Intergenic
1171766940 20:29294864-29294886 ATTTGTTACTAGCTTTGTACTGG - Intergenic
1171865040 20:30482740-30482762 ATTTGTTACTAACTTTGTACTGG - Intergenic
1171940818 20:31327875-31327897 TTTTTTTTTTAGCTTTGTTCAGG - Intergenic
1176661656 21:9641493-9641515 ATTTGTTACTAACTTTGTACTGG - Intergenic
1178072410 21:28983262-28983284 ATTTGTTCTTGGCTTTGTCATGG - Intronic
1180467436 22:15625996-15626018 ATTTTTTTGTACGTTTGTCACGG - Intergenic
1181016567 22:20072922-20072944 ATTTGTTTGTAGCTAAGTTTAGG + Intergenic
1182404386 22:30112252-30112274 ATTTATTTGTAGCTTAGTCATGG + Intronic
1184964721 22:47962863-47962885 ATTTGTTTGGTGTTTTGTCTTGG - Intergenic
1185293810 22:50042803-50042825 TTCTGTTTGTAGCATTCTCCTGG - Intronic
950035786 3:9884552-9884574 TTTTGCTTGTACCTTTCTCCTGG - Intergenic
952026172 3:29085629-29085651 CTTTGTTTGTTTCTATGTCCAGG + Intergenic
954727369 3:52624661-52624683 ATTTGTTGCTAGCTTTGCCAGGG - Intronic
955391148 3:58523224-58523246 ATATGTTTTTTGCTTTGTCAGGG + Intronic
956275559 3:67496523-67496545 ATTTGTTTCTAAGTTTATCCAGG - Intronic
956356710 3:68401677-68401699 CTTTGTGTGTAGCTTGGACCAGG + Intronic
957493387 3:80959004-80959026 GTTTGTTTGTAGTTTTGTATCGG + Intergenic
957882349 3:86235650-86235672 GTTTGTTTTCAGCTTTGTTCAGG - Intergenic
958501701 3:94919096-94919118 GTTTGTTTGTTTGTTTGTCCAGG + Intergenic
958679114 3:97303787-97303809 ATTTATTTGTAATTTTGTCTGGG - Intronic
959883858 3:111476612-111476634 ATTTGTTGAGTGCTTTGTCCTGG - Intronic
960406874 3:117271959-117271981 CTTTTTTTGTAGCATTTTCCCGG + Intergenic
962315652 3:134357971-134357993 ATTTGTTTCTAACTTTGAACTGG + Intronic
963691517 3:148508946-148508968 TTTTGCTTCTTGCTTTGTCCTGG + Intergenic
966129825 3:176624799-176624821 ATTTGTGTGTACCCTTTTCCTGG - Intergenic
966172995 3:177103678-177103700 TTGTGTTTGTACCTTTGTCTAGG - Intronic
967082655 3:186064590-186064612 ATGTCTTTCTGGCTTTGTCCTGG + Intronic
968841931 4:3013728-3013750 TTTTTTTTGTAGCTTTTTGCAGG - Exonic
969147157 4:5133963-5133985 CTTTGTTTAAACCTTTGTCCAGG + Intronic
969666828 4:8562737-8562759 ATTAGATTGTAGCCTTGTCCAGG - Intronic
970072170 4:12172880-12172902 ATTTGTCTTTAGCACTGTCCAGG - Intergenic
971254662 4:25003374-25003396 ATTTGTTTGTTGATTTTTCTTGG + Exonic
971271108 4:25146841-25146863 ATTTTTTGGTGGCTTTGGCCAGG - Intronic
972403722 4:38727826-38727848 ATTTGTTTGCAGATTTGCCTGGG + Intergenic
972866422 4:43238680-43238702 ATTTGTTTGTTGCCTTTTACAGG + Intergenic
973189120 4:47367028-47367050 ATATGGTGGTAGCTATGTCCAGG - Intronic
973907295 4:55545692-55545714 AAGTGTTTGTAGCTTTGTAGAGG - Intronic
974350417 4:60737039-60737061 ATTTGTTTGTAACTTTGTAAAGG + Intergenic
976568263 4:86577435-86577457 ATTTCTTTGTATCATTGTTCTGG - Intronic
977216245 4:94287253-94287275 ATTTGTCTTCAGCTGTGTCCCGG + Intronic
981522651 4:145679541-145679563 ATTTGTTTAAAGCTTAATCCTGG - Intergenic
981673671 4:147315853-147315875 ATTTGCTTATGGCATTGTCCTGG - Intergenic
982386662 4:154812537-154812559 GTTTGTTTGTATCTATTTCCTGG + Intronic
984657706 4:182337016-182337038 ATTTGATTGTAGTTTTCTTCTGG - Intronic
984887995 4:184468139-184468161 ATGTATTTGTCTCTTTGTCCAGG - Intronic
985413742 4:189715053-189715075 ATTTGTTACTAACTTTGTGCTGG + Intergenic
988510845 5:31863329-31863351 ATATTTTTGTAGCTTTTCCCAGG + Intronic
989609910 5:43281053-43281075 AGTTGTTAGTACCTTTGTCCTGG - Intergenic
989752400 5:44911824-44911846 ATTTCTTTGTTGTTTTGTCTTGG - Intergenic
991090485 5:62689633-62689655 ATTTGTTTATACCTATTTCCGGG - Intergenic
992227908 5:74636644-74636666 AGTTGTCTCTGGCTTTGTCCTGG - Intronic
994044000 5:95287417-95287439 CTTTCTTTGTAGCTCTGTTCTGG + Intergenic
997111244 5:131076864-131076886 ATTTGTTTTTAGCTTTGCTATGG + Intergenic
997302484 5:132815369-132815391 TTCTGTTTCCAGCTTTGTCCAGG + Exonic
997918064 5:137949217-137949239 AATTGGTTTTAGCTTTGACCGGG + Intronic
998411553 5:141915100-141915122 ATTTACTTGTAACATTGTCCAGG + Intergenic
1000018002 5:157295228-157295250 ATTTGTCTGGATCTTTTTCCTGG + Intronic
1000678090 5:164147816-164147838 ATTTGTTTGTAGTTTTTATCTGG + Intergenic
1002254718 5:177950683-177950705 ATTGGTTTTTACCTCTGTCCTGG + Intergenic
1003517139 6:6826733-6826755 CTCTGTTTGTAGCTCTGTGCTGG + Intergenic
1005460139 6:26060682-26060704 ATTTGTTTGTGGCTTTCTTGAGG - Intergenic
1006118221 6:31786775-31786797 ATTTGCTTGTATCTGTTTCCAGG - Intronic
1007387404 6:41529092-41529114 ATTAGTCTGGAGCTTTGTCTGGG + Intergenic
1008741950 6:54619602-54619624 ATTTGTTTGTTGCTGTGCGCAGG + Intergenic
1010927327 6:81758602-81758624 ATTTTTTTGTAAATTTGTGCTGG + Intergenic
1011113776 6:83867277-83867299 CTGTGTTTGTACCTTTGTTCAGG - Intronic
1011938745 6:92815843-92815865 ATTTGCTTGTTCCTATGTCCAGG - Intergenic
1012466320 6:99520594-99520616 ATTTGACTATAGCTTTGTCAGGG - Intronic
1012762736 6:103321978-103322000 ATTTTTTTGTAACTTTGGCCTGG - Intergenic
1015693156 6:135949161-135949183 ATTTGATTGTAGCTTTCACCTGG + Intronic
1016410055 6:143773399-143773421 ATTTTTTTTTAACTTTGTGCTGG + Intronic
1017849082 6:158287738-158287760 ATTAGCTTGGAGCTTAGTCCAGG + Intronic
1018208687 6:161459686-161459708 ACTTATATGTAGATTTGTCCAGG + Intronic
1021237997 7:18166813-18166835 ATTTGTTTGTAGCTTTGTCCTGG - Intronic
1023621318 7:42076086-42076108 ATTTTTTTGTAGTACTGTCCAGG - Intronic
1024837039 7:53533412-53533434 ATTTGGTAGTGGCTATGTCCAGG - Intergenic
1024944309 7:54793281-54793303 ATTTGTCTGTTCCTATGTCCAGG - Intergenic
1025722106 7:64026475-64026497 ATTTTTTTGTGGCTAGGTCCAGG + Intergenic
1029224907 7:99018911-99018933 ATTAGTTTGTAGTTTTCTCCTGG + Intergenic
1030576969 7:111300213-111300235 ATTTGTTTGCAGCTTTGCTGAGG + Intronic
1033338302 7:140471854-140471876 ATTTGTTTATAAATTTGTTCAGG - Intronic
1034970310 7:155414920-155414942 ATTTGTTTCTACCTGTGACCTGG - Intergenic
1036288397 8:7464585-7464607 ATTTGCTTCCAGCTTTCTCCAGG - Intergenic
1036333078 8:7846943-7846965 ATTTGCTTCCAGCTTTCTCCAGG + Intergenic
1036742231 8:11373827-11373849 ATTTCTTTGTGGCTTAGTCTTGG - Intergenic
1037321701 8:17649598-17649620 ATTTGTTTGTAGTTTTTCCAAGG + Intronic
1039822561 8:41146699-41146721 AGTTGTTTTTAGCTTTGCCCTGG - Intergenic
1040131049 8:43797163-43797185 ATTTGTTTCTAGTTTTATCTGGG - Intergenic
1041403383 8:57468645-57468667 ATTTGTTTGTATCTTTGTGTGGG + Intergenic
1048094513 8:131276910-131276932 ATTTGTTTATATCTTTGCTCTGG + Intergenic
1048313763 8:133347031-133347053 ATTGTTTTGTATTTTTGTCCTGG + Intergenic
1050610090 9:7343243-7343265 TTTTGTTTCTATCTTTGCCCAGG + Intergenic
1051915871 9:22207100-22207122 ATAAGTATTTAGCTTTGTCCAGG + Intergenic
1058412059 9:104744602-104744624 ATTTATTTGTAGATGTCTCCTGG - Intergenic
1059212163 9:112523485-112523507 ATGTGGTTTTAGATTTGTCCTGG + Intronic
1059943457 9:119381038-119381060 ATTTGTTTATATCTTTGCCTAGG - Intergenic
1060768828 9:126315321-126315343 TTTTCTTTGTAGCTTCTTCCTGG + Intergenic
1060911877 9:127357844-127357866 ATTTGTTAGATGATTTGTCCTGG + Intronic
1203583387 Un_KI270746v1:37133-37155 ATTTGGATATAACTTTGTCCAGG + Intergenic
1203639218 Un_KI270750v1:143336-143358 ATTTGTTACTAACTTTGTACTGG - Intergenic
1185908459 X:3960009-3960031 ATTTGTTTTTAGCTCTATCTTGG - Intergenic
1187433605 X:19247242-19247264 AATTGATGGTAGCTTGGTCCAGG - Intergenic
1187727147 X:22215174-22215196 ATTTGTTTGTACCTTAGGCTAGG + Intronic
1190762785 X:53450588-53450610 AATTGTTTGTATATATGTCCAGG - Intergenic
1194275203 X:91870997-91871019 ATTCATTTGTAGCCTTGTCAAGG - Intronic
1196267028 X:113661933-113661955 TTTTGTTTGTGCCTATGTCCTGG - Intergenic
1196380071 X:115079699-115079721 ATTTGTTTATAACATTGGCCAGG - Intergenic
1196553103 X:117053888-117053910 GTTTGTTTTTAGTTTTCTCCAGG - Intergenic
1197111795 X:122783889-122783911 ATTTGTTTGTTTCTTTGTTTTGG - Intergenic
1200592452 Y:5092411-5092433 ATTCATTTGTAGCCTTGTCAAGG - Intronic
1201892169 Y:18954562-18954584 ATTTGTTTTTAGCTCTGTCTTGG + Intergenic