ID: 1021240698

View in Genome Browser
Species Human (GRCh38)
Location 7:18197107-18197129
Sequence ACTGGGACATTGACCATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021240690_1021240698 21 Left 1021240690 7:18197063-18197085 CCCCCCTTATGTAAGAGAGAATT 0: 1
1: 1
2: 4
3: 32
4: 224
Right 1021240698 7:18197107-18197129 ACTGGGACATTGACCATTACTGG 0: 1
1: 0
2: 1
3: 10
4: 127
1021240692_1021240698 19 Left 1021240692 7:18197065-18197087 CCCCTTATGTAAGAGAGAATTCT 0: 1
1: 0
2: 3
3: 21
4: 301
Right 1021240698 7:18197107-18197129 ACTGGGACATTGACCATTACTGG 0: 1
1: 0
2: 1
3: 10
4: 127
1021240697_1021240698 -8 Left 1021240697 7:18197092-18197114 CCTGACAGTCTTTAAACTGGGAC 0: 1
1: 0
2: 7
3: 58
4: 231
Right 1021240698 7:18197107-18197129 ACTGGGACATTGACCATTACTGG 0: 1
1: 0
2: 1
3: 10
4: 127
1021240694_1021240698 17 Left 1021240694 7:18197067-18197089 CCTTATGTAAGAGAGAATTCTCT 0: 1
1: 0
2: 3
3: 23
4: 250
Right 1021240698 7:18197107-18197129 ACTGGGACATTGACCATTACTGG 0: 1
1: 0
2: 1
3: 10
4: 127
1021240691_1021240698 20 Left 1021240691 7:18197064-18197086 CCCCCTTATGTAAGAGAGAATTC 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1021240698 7:18197107-18197129 ACTGGGACATTGACCATTACTGG 0: 1
1: 0
2: 1
3: 10
4: 127
1021240693_1021240698 18 Left 1021240693 7:18197066-18197088 CCCTTATGTAAGAGAGAATTCTC 0: 1
1: 0
2: 1
3: 23
4: 219
Right 1021240698 7:18197107-18197129 ACTGGGACATTGACCATTACTGG 0: 1
1: 0
2: 1
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021240698 Original CRISPR ACTGGGACATTGACCATTAC TGG Intronic
901494006 1:9610967-9610989 TCTGGGACATTGACCTCTAATGG + Intronic
904545135 1:31264122-31264144 AATGGTACATTCACCAGTACTGG + Intronic
906118954 1:43374784-43374806 CCTGGGCCATGGACCAGTACTGG - Intergenic
907530533 1:55091167-55091189 CCTGGGCCATGGACCAGTACCGG + Intronic
907911744 1:58833316-58833338 AATGGGCCTGTGACCATTACAGG + Intergenic
908120005 1:60977163-60977185 CCTGGGTCATTCACTATTACTGG + Intronic
909469759 1:76013859-76013881 ACTGATACATAGACCCTTACAGG - Intergenic
913706726 1:121432996-121433018 AAAGGGACATTGACTTTTACAGG - Intergenic
914674200 1:149895836-149895858 GTTGGGACATTAACCATCACAGG + Intronic
920746586 1:208634838-208634860 GCTGGGACATTGATCTTTCCTGG + Intergenic
920801278 1:209189990-209190012 ACGGTGACATTTACCATAACTGG + Intergenic
921274041 1:213499652-213499674 AACAGGACATTGACCAGTACTGG + Intergenic
923668673 1:236021267-236021289 ACTGGGAAACTGACGATTGCAGG + Intronic
924169725 1:241326040-241326062 ACTGGGAAAGTGACCTTTGCTGG - Intronic
1070032556 10:72691938-72691960 AGTGGGACATAGTCAATTACGGG - Intergenic
1075358720 10:121809769-121809791 ACTGGGACATTCAACATTCAAGG + Intronic
1077862528 11:6195794-6195816 CCTGTGACGTTGACCATTAGAGG - Intergenic
1078883541 11:15477247-15477269 ACCTGGACATTGAGCATGACAGG + Intergenic
1080019392 11:27544185-27544207 ACTGGGACACTGACAGATACTGG - Intergenic
1086486034 11:87303097-87303119 TCTGGGCCATGGACCAGTACTGG + Intronic
1088362879 11:109009524-109009546 CCTGGGGCATGGACCAGTACTGG - Intergenic
1094366797 12:29691572-29691594 ACTGTCAAACTGACCATTACCGG + Intronic
1095915368 12:47472761-47472783 CCTGGGCCATAGACCAATACTGG + Intergenic
1097341552 12:58444103-58444125 CCTGGGACCTTGTCCAGTACAGG + Intergenic
1101375531 12:104168115-104168137 ACTGGGCCATGGACCAGTACTGG + Intergenic
1104152622 12:126098153-126098175 ACTGGGACATGGACCACTCTGGG - Intergenic
1105256270 13:18745586-18745608 ACTGGGCCATTGAACACCACTGG + Intergenic
1107437819 13:40396095-40396117 CCTGGGCCATGGACCAATACTGG - Intergenic
1108005823 13:45945376-45945398 CCTGGGACATTCACCATCACAGG - Intergenic
1113601247 13:111569703-111569725 ACTGGGACAGGGAACATTTCTGG + Intergenic
1115036278 14:28860608-28860630 ACTGGAACATTCACCATTGCTGG - Intergenic
1117767794 14:59100911-59100933 CCTGGGCCATGGACCAGTACCGG - Intergenic
1120477761 14:85009663-85009685 ACTGGCACAATACCCATTACAGG + Intergenic
1122960561 14:105092036-105092058 ACTGGGCCATTGCCCAGTGCTGG - Intergenic
1202835750 14_GL000009v2_random:76442-76464 ACTGGGCCATTGAACACCACTGG - Intergenic
1124104355 15:26723603-26723625 ATTGGGACAATGACCATGGCTGG - Intronic
1126360764 15:47843482-47843504 ACTGGGACACTGACATCTACAGG - Intergenic
1128790341 15:70428701-70428723 ACTGGGACAGTGACAAATTCTGG - Intergenic
1135234795 16:20745219-20745241 ACTGGGCCATTGTCCATGTCTGG - Intronic
1141237105 16:82228874-82228896 ACTGGGACCTTGTTCATGACAGG + Intergenic
1145849214 17:28075048-28075070 AATGGCACATTTACCATTAGTGG + Intronic
1146701902 17:34968279-34968301 ACTGGGACATAGAGAATTAAGGG - Intronic
1148209663 17:45800530-45800552 ACTGGGAGATGGACCATTTGTGG - Intronic
1149268756 17:54954608-54954630 ACTGGAACCTTGGCCAATACAGG - Intronic
1154434765 18:14335093-14335115 ACTGGGCCATTGAACACCACTGG - Intergenic
1155549125 18:26946528-26946550 AGTGGGAAACTGACCATTAAGGG + Intronic
1156823312 18:41399101-41399123 CCTGGGCCATGGACCAGTACTGG + Intergenic
1157904596 18:51558310-51558332 CCTGGGCCATGGACCAGTACTGG + Intergenic
1158504687 18:58036129-58036151 ACTGGGACAGGGACATTTACTGG + Intergenic
935611227 2:105027635-105027657 CCTGGGCCATGGACCAGTACTGG - Intergenic
938235503 2:129702961-129702983 ACATAGACATTGACCCTTACTGG - Intergenic
938571003 2:132561819-132561841 AGGGGGACATTGACCTTTTCTGG - Intronic
940836811 2:158531026-158531048 CCAGGGACATTGACCATTAGGGG - Intronic
942213841 2:173698571-173698593 CCAGGGACATTGACCATCAGAGG + Intergenic
945497925 2:210532615-210532637 ATTGGGACATATACCACTACAGG - Intronic
948118238 2:235509787-235509809 TCTGGGCCATGGACCAGTACTGG + Intronic
1169637420 20:7707677-7707699 GCTGGGCCATTGAGCATCACAGG + Intergenic
1170787574 20:19480816-19480838 CCTGGGACACTGATCCTTACTGG + Intronic
1171783872 20:29445551-29445573 TCGGGGACAGTGCCCATTACTGG - Intergenic
1171883018 20:30631851-30631873 ACTGGGCCATTGAACACCACTGG + Intergenic
1173212459 20:41046235-41046257 ACTGGCCCAGTGAACATTACTGG - Intronic
1176015821 20:62931539-62931561 AATAGGACATTTACCCTTACAGG + Intronic
1176842266 21:13850610-13850632 ACTGGGCCATTGAACACCACTGG + Intergenic
1177863556 21:26484661-26484683 ACTGGGCCATTGATTATTTCTGG - Intronic
1178596491 21:33958079-33958101 CCTGGGCCATGGACCATTACAGG - Intergenic
1181428307 22:22858227-22858249 ACAGCCACACTGACCATTACTGG + Intronic
1182439746 22:30356325-30356347 GCTGGGAAATTAGCCATTACTGG + Intronic
1182720263 22:32392662-32392684 ATGGGGACATTGACAATTTCTGG - Intronic
1183114500 22:35680045-35680067 ACTGGAACTCTAACCATTACTGG - Intergenic
1185388231 22:50546290-50546312 ACTGGGACAGTGACAATGACTGG + Intergenic
951851637 3:27147637-27147659 ACTGTGACATTACCCATTATGGG - Intronic
953687089 3:45086411-45086433 TCTGGGACACTGCCCATTTCTGG - Intronic
959098742 3:101986290-101986312 ACTGGGGCATTGAGCATTCATGG - Intergenic
965189463 3:165509283-165509305 GCTGGGACATTGATCTTTTCTGG + Intergenic
965363831 3:167774521-167774543 CCTGGGCCATGGACCAGTACTGG + Intronic
970690431 4:18613224-18613246 CCTGGGCCATCGACCAGTACTGG - Intergenic
973238210 4:47928964-47928986 ACAGGGAAATGGACCATTGCTGG + Intronic
973366682 4:49214167-49214189 ACTGGGCCATTGAACACCACTGG + Intergenic
973393913 4:49578144-49578166 ACTGGGCCATTGAACACCACTGG - Intergenic
975261679 4:72309562-72309584 TCTGGGATGTTGACCACTACTGG - Intronic
975303320 4:72817732-72817754 AGGGGGACATTGACAACTACTGG - Intergenic
976668160 4:87622503-87622525 ACTGGGCCACAGACCAATACCGG - Intergenic
977966097 4:103150158-103150180 ACTGAGACATTAACCTTCACAGG + Intronic
981414320 4:144471826-144471848 ACTGGTACATTTAGCTTTACAGG - Intergenic
984239503 4:177200614-177200636 ACTGTAACATTGACCCTTCCTGG - Intergenic
1202764205 4_GL000008v2_random:136792-136814 ACTGGGCCATTGAACACCACTGG + Intergenic
986197964 5:5555259-5555281 CCTGGGCCATGGACCAGTACTGG + Intergenic
988594030 5:32574575-32574597 ACAGTGATATTGACCATAACAGG - Intronic
991084434 5:62635660-62635682 AATGGGCCACTGACCAGTACAGG - Intergenic
993224232 5:85145248-85145270 ACTGGGGAATTGCTCATTACAGG - Intergenic
993955622 5:94228926-94228948 CCTGGGACTCTGACCATTCCAGG + Intronic
994038075 5:95225579-95225601 CTTGGGACATTGACCATTCTTGG - Intronic
995700683 5:114931545-114931567 ATTGGGACATTGACTAGTTCAGG - Intergenic
995709613 5:115021586-115021608 TCTGGGCCATGGACCAATACTGG - Intergenic
996343927 5:122469552-122469574 ACCTGCACATTGACCACTACTGG - Intergenic
998872924 5:146570555-146570577 TCTGGGCCATGGACCAGTACTGG - Intergenic
999424739 5:151477249-151477271 CCTGGGACATTCACCCTTTCAGG - Intronic
1004529258 6:16438243-16438265 CCTGGGCCATGGACCATTATGGG - Intronic
1007931073 6:45691022-45691044 ACTGGGGCACTGACCATTGAGGG + Intergenic
1021240698 7:18197107-18197129 ACTGGGACATTGACCATTACTGG + Intronic
1023770449 7:43552119-43552141 ACTGGGAAATTGACCATCACTGG - Intronic
1027154672 7:75758210-75758232 CCTGGGCCATGGACCAGTACTGG - Intergenic
1031813992 7:126409083-126409105 ACAGGGACATTGACCATGAATGG + Intergenic
1033932177 7:146537700-146537722 CCTGGGACAGTGAGCATTTCAGG + Intronic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1034718334 7:153264271-153264293 ACTGGGACATTGCCTAGTGCAGG - Intergenic
1036138178 8:6181252-6181274 ACTGGGTCCTTGAACATTCCTGG - Intergenic
1037867925 8:22462431-22462453 ACTGGAACATTTACCATTTAGGG + Intronic
1038092380 8:24268819-24268841 CCCGGGCCATGGACCATTACTGG + Intergenic
1040426604 8:47293885-47293907 ACTGGGAGATTGACAGTGACAGG + Exonic
1042120185 8:65478872-65478894 ACTGGGACATTGAGGATTTGTGG + Intergenic
1042849725 8:73204659-73204681 ACTGGGTCATGGTCCATTCCTGG - Intergenic
1045676616 8:104614799-104614821 CCTGGGCCACTGACCAGTACTGG - Intronic
1045908873 8:107381753-107381775 ACTGGGACAGTGGGCATGACAGG + Intronic
1046173384 8:110543047-110543069 ACTGAAACATTGACTATTCCTGG + Intergenic
1049390886 8:142370121-142370143 ACTAGGACATAGGCCATCACAGG + Intronic
1049918490 9:341721-341743 CCCGGGCCATAGACCATTACTGG + Intronic
1051216694 9:14805225-14805247 ACTGAGAAATTGACTATTATTGG - Intronic
1052730313 9:32277654-32277676 ACTGGGACATTGGTCTTTTCTGG - Intergenic
1053513973 9:38713581-38713603 ACTGGAACACGGACAATTACAGG + Intergenic
1054820878 9:69519322-69519344 ACTGGGCCATGGACCAGTATTGG - Intronic
1057352832 9:94315181-94315203 ACTGAGTCCCTGACCATTACTGG - Intergenic
1057654915 9:96942410-96942432 ACTGAGTCCCTGACCATTACTGG + Intronic
1057675371 9:97132915-97132937 ACTGGGACTTTGGGCACTACTGG + Intergenic
1059692462 9:116698844-116698866 ACTGGAAGATTGAACATTCCTGG - Exonic
1062382916 9:136296215-136296237 ACTGAGGCATGGAGCATTACAGG + Intronic
1062549247 9:137078348-137078370 ACCGGGACATTGCCCAGAACCGG + Intronic
1203444499 Un_GL000219v1:42466-42488 TCGGGGACAGTGCCCATTACTGG - Intergenic
1203544954 Un_KI270743v1:121665-121687 ACTGGGCCATTGAACATCACTGG + Intergenic
1186063743 X:5739328-5739350 ACTGGAGCATTGACTAGTACAGG + Intergenic
1186592380 X:10944526-10944548 CCTGGGCCATGGACCAGTACTGG - Intergenic
1187171386 X:16855384-16855406 ACTGGGAAAATAGCCATTACTGG - Intronic
1192104064 X:68296184-68296206 ACAAGGACAATGACCATGACAGG + Intronic
1192163878 X:68810859-68810881 ACTGGGACATTGGCTCTTCCTGG + Intergenic
1194023027 X:88717322-88717344 ACTTGGACATTGATCATAAATGG + Intergenic
1194044927 X:88990697-88990719 ACAGGGAGATTGACTATTACAGG + Intergenic
1197549639 X:127874008-127874030 CCTGGGCCATGGACCAGTACAGG - Intergenic
1198188767 X:134282816-134282838 CCTGGGCCATGGACCAGTACTGG + Intergenic
1201708679 Y:16965685-16965707 CCTGGGCCATGGACCACTACTGG - Intergenic