ID: 1021241056

View in Genome Browser
Species Human (GRCh38)
Location 7:18201548-18201570
Sequence TGCTCAGCTAGTCCTCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021241056_1021241066 26 Left 1021241056 7:18201548-18201570 CCTCAGGGAGGACTAGCTGAGCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1021241066 7:18201597-18201619 AGGGCCTCCTGCCAAGGGAAGGG 0: 1
1: 0
2: 1
3: 29
4: 215
1021241056_1021241062 20 Left 1021241056 7:18201548-18201570 CCTCAGGGAGGACTAGCTGAGCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1021241062 7:18201591-18201613 GAACCAAGGGCCTCCTGCCAAGG 0: 1
1: 0
2: 1
3: 18
4: 169
1021241056_1021241063 21 Left 1021241056 7:18201548-18201570 CCTCAGGGAGGACTAGCTGAGCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1021241063 7:18201592-18201614 AACCAAGGGCCTCCTGCCAAGGG No data
1021241056_1021241059 6 Left 1021241056 7:18201548-18201570 CCTCAGGGAGGACTAGCTGAGCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1021241059 7:18201577-18201599 CTGAGAGACTCCAGGAACCAAGG No data
1021241056_1021241057 -2 Left 1021241056 7:18201548-18201570 CCTCAGGGAGGACTAGCTGAGCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1021241057 7:18201569-18201591 CAGCACCTCTGAGAGACTCCAGG 0: 1
1: 0
2: 3
3: 16
4: 212
1021241056_1021241065 25 Left 1021241056 7:18201548-18201570 CCTCAGGGAGGACTAGCTGAGCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1021241065 7:18201596-18201618 AAGGGCCTCCTGCCAAGGGAAGG No data
1021241056_1021241060 7 Left 1021241056 7:18201548-18201570 CCTCAGGGAGGACTAGCTGAGCA 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1021241060 7:18201578-18201600 TGAGAGACTCCAGGAACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021241056 Original CRISPR TGCTCAGCTAGTCCTCCCTG AGG (reversed) Intronic
900291243 1:1924404-1924426 TCCTCAGCTCGCCCTCCCAGAGG - Exonic
903231516 1:21925231-21925253 TATTCAGCTAGTGCTGCCTGAGG - Intronic
904854920 1:33490482-33490504 TGCTCAGCTAGTCTGTACTGTGG - Intronic
906688910 1:47779870-47779892 TACTCTCCTAGACCTCCCTGGGG - Intronic
911101976 1:94102463-94102485 TGCTCAGGAAGGCCTTCCTGAGG - Intronic
915260411 1:154672981-154673003 TTCTCAGTCGGTCCTCCCTGTGG + Intergenic
917214379 1:172662997-172663019 TGCTCAGCTAATGTTCTCTGTGG + Intronic
917352221 1:174090090-174090112 TTCTCAGCCAGTCCAGCCTGTGG - Intergenic
917442578 1:175080253-175080275 TCCTCAGCTACTACCCCCTGGGG + Exonic
921100356 1:211923552-211923574 TGCTCAGCTGCTCTTCTCTGGGG + Intergenic
921852507 1:219946422-219946444 TGTTCATCTAGTCCTTCCAGGGG + Intronic
924578677 1:245303796-245303818 TCTTCAGCAAGTCCTGCCTGAGG + Intronic
924904827 1:248441364-248441386 TGCTCAGCCAGCTCTCCCTCAGG + Exonic
924923060 1:248650678-248650700 TGCTCAGCCAGCTCTCCCTCAGG - Exonic
1063321871 10:5058825-5058847 TTCTCAGTCAGTCCTCCTTGTGG - Intronic
1065798095 10:29325407-29325429 AGCTCTGCTAGGCCTCACTGTGG - Intergenic
1067087853 10:43252337-43252359 TGCCCACCTAGTCCTGGCTGTGG - Intronic
1067291696 10:44948248-44948270 TGCACAGCTGGGCATCCCTGAGG - Intergenic
1073469415 10:103713625-103713647 TGGTCAGGAAGGCCTCCCTGAGG - Intronic
1076208972 10:128625566-128625588 TGCTGTGCTGGCCCTCCCTGGGG + Intergenic
1076815025 10:132910338-132910360 GGCTCAGCTGCTCCTTCCTGCGG - Intronic
1079478395 11:20856082-20856104 TGCTCAGCTATTCCTCTTTTAGG + Intronic
1081485404 11:43523252-43523274 TTCTCTGCTATTCCTCCTTGGGG - Intergenic
1083344008 11:61977006-61977028 TGCTTGGCTGGTCCTCCCAGGGG + Intergenic
1083622476 11:64056026-64056048 AGCACAGTTTGTCCTCCCTGTGG + Intronic
1083777287 11:64900496-64900518 TGCTCAGCTGGATCTCCATGAGG + Exonic
1084432283 11:69117746-69117768 TCCTCAGATGGTCTTCCCTGTGG - Intergenic
1085644768 11:78215906-78215928 GGCTCAGCTCATCCTCCCTCTGG - Exonic
1086195500 11:84134113-84134135 TGCTCAACTAGAGCTCCTTGAGG - Intronic
1087205867 11:95392952-95392974 TGCTCTGCTGGTCCTCCCAGAGG - Intergenic
1087828869 11:102797293-102797315 GGCTCAGTTTGTCCTCACTGAGG - Exonic
1089296003 11:117468678-117468700 TGGGCAGCTGGTCCTTCCTGGGG - Intronic
1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG + Intronic
1093580705 12:20781888-20781910 TCCTCAGTCAGTCCTCCTTGTGG - Intergenic
1095626417 12:44319484-44319506 TGCCCACCTTCTCCTCCCTGGGG + Intronic
1097915231 12:65014083-65014105 TTCTCTGCTAGAACTCCCTGGGG + Intergenic
1097923111 12:65098457-65098479 TGCTGAGCCAGTCCTGACTGGGG - Intronic
1099369512 12:81812217-81812239 TTCTCAGCTAGTCTAGCCTGTGG + Intergenic
1100057050 12:90524640-90524662 TCCTCAGCTAGTCATCCATGGGG - Intergenic
1100156431 12:91805015-91805037 TCCTCAGCTGGTCCAGCCTGGGG + Intergenic
1102960725 12:117091718-117091740 TACTGAGCTTGTTCTCCCTGGGG + Intronic
1103138467 12:118527980-118528002 TGTTGAGCAAGTCCACCCTGTGG + Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1108421807 13:50258083-50258105 TGCTCAGCTAGTGCTCTATGGGG - Intronic
1109175372 13:59148899-59148921 AGCTCAGCTTATCCTGCCTGGGG - Intergenic
1110534278 13:76632831-76632853 TGCTAACCTAGGCATCCCTGAGG - Intergenic
1110931614 13:81225375-81225397 GTCTCAGCTAGTCCTCCATCGGG - Intergenic
1111589425 13:90324390-90324412 TTTTAAGCTAGGCCTCCCTGGGG - Intergenic
1112133789 13:96553041-96553063 GGATCAGCAAGTCCTCCCTGGGG + Intronic
1119568626 14:75650172-75650194 TCATCAGAAAGTCCTCCCTGAGG - Exonic
1120439757 14:84521112-84521134 AGCTCAGCTAGTGCTCGCAGAGG - Intergenic
1121181567 14:91932958-91932980 GGCTCAGCTTGTCATCCCTCTGG + Intronic
1122022644 14:98851816-98851838 TGTTCACCTGGTCCTCTCTGGGG - Intergenic
1122518627 14:102326787-102326809 CGCTCAGCCTGACCTCCCTGGGG + Exonic
1123055757 14:105568872-105568894 TGCACTGCGTGTCCTCCCTGGGG - Intergenic
1123080114 14:105688391-105688413 TGCACTGCGTGTCCTCCCTGGGG - Intergenic
1123080162 14:105688645-105688667 TGCACTGCGTGTCCTCCCTGGGG - Intergenic
1124853961 15:33368971-33368993 TGCACAGCAAGAGCTCCCTGAGG - Intronic
1127660183 15:61093417-61093439 TGCCCAGATAGTCCACCATGTGG - Intronic
1128876565 15:71206365-71206387 TGCTCAGCTAGGACAACCTGGGG - Intronic
1130889067 15:88117988-88118010 TGCCCAGCTTATCCTCCATGAGG + Intronic
1130948722 15:88568802-88568824 TTCTGAGCTATTCCTCGCTGTGG - Intergenic
1132396732 15:101480108-101480130 TGATCAGCCAGACCGCCCTGGGG - Intronic
1132547620 16:540504-540526 TGCTCAGCTCCTGCACCCTGGGG - Intronic
1132648625 16:1010451-1010473 TGTTCAGCAAGTCCTCCCCATGG + Intergenic
1136517760 16:30778097-30778119 TGGTCAGAGAGGCCTCCCTGGGG + Intergenic
1137670444 16:50275283-50275305 TGCGCAGCTAGCCCAACCTGGGG + Intronic
1139363884 16:66421478-66421500 TGGCCAGTTAGTCCTGCCTGTGG + Intergenic
1139636170 16:68259923-68259945 GGCCCAGCCAGTCCACCCTGTGG - Exonic
1141447517 16:84071234-84071256 AGCTGAGCCAGTCCTCCCTCCGG - Intronic
1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG + Intronic
1142884391 17:2903749-2903771 TGACCAGCCAGCCCTCCCTGTGG - Intronic
1143350348 17:6283611-6283633 TGCTCTGCCAGTCCTCACAGTGG - Intergenic
1144065095 17:11617639-11617661 TGCCCAGCAACTGCTCCCTGGGG + Intronic
1147970446 17:44216776-44216798 TGCTCAACTCTTCCTCCCTAGGG + Intronic
1150012365 17:61516738-61516760 TGCTCACCTTGGCCTCCCAGAGG - Intergenic
1151159619 17:72153873-72153895 GGCTCAGTTAGTCCTCTCTCCGG + Intergenic
1151759798 17:76094140-76094162 TGCTCAGCGAATCCCGCCTGAGG - Intronic
1156355662 18:36338316-36338338 TGCTCAGCTCAGCCTCCCTGGGG + Intronic
1157476081 18:48024426-48024448 TGGACAGCTTTTCCTCCCTGAGG - Intergenic
1159716363 18:71828164-71828186 TTCTGAGAAAGTCCTCCCTGAGG - Intergenic
1159928000 18:74285753-74285775 GGCTCAACCAGTCCTCCCTCTGG - Intronic
1161002052 19:1915448-1915470 TGCTCAGCCAGCACTGCCTGAGG - Intronic
1161048787 19:2151232-2151254 GGCTCACCTCGTCCTCCTTGTGG + Exonic
1162743340 19:12785880-12785902 TGCTGAGCTAGGCCTCCTAGGGG - Intronic
1163751691 19:19081915-19081937 TGATCAGGTCGGCCTCCCTGAGG - Intronic
1165008900 19:32828877-32828899 TGCACAGCGTGTCCTCCCAGGGG - Intronic
1166159158 19:40938690-40938712 TGCACAGCTACTCATTCCTGAGG - Intergenic
1166516121 19:43448329-43448351 TGCTTAGCTAGTCCTCAATTTGG - Intergenic
1166714808 19:44960222-44960244 TGGTCAGAGAGGCCTCCCTGAGG - Intronic
1168076844 19:53985132-53985154 TGCTCAGCAAGTGTTTCCTGAGG + Exonic
926008894 2:9393204-9393226 TTCTCAGCTAGAACTCCCTGGGG - Intronic
928160927 2:28923842-28923864 TGCCCAGGTAGTCCTCACTGTGG - Intronic
929663210 2:43810626-43810648 TGCTCAGACAGTACTCCCTTGGG - Intergenic
932783754 2:74581172-74581194 GGCACAGGTTGTCCTCCCTGGGG + Intronic
933895968 2:86809614-86809636 TGCTCACCTCTTCCTCCCTGCGG - Intergenic
934149644 2:89134106-89134128 TCCTCAGCCAGCTCTCCCTGAGG + Intergenic
934196581 2:89841912-89841934 TCCTCAGCCAGCTCTCCCTGAGG - Intergenic
934217651 2:90047922-90047944 TCCTCAGCCAGCTCTCCCTGAGG - Intergenic
937026157 2:118699490-118699512 TGGTCAGATGCTCCTCCCTGGGG + Intergenic
937892223 2:126947387-126947409 TGCTCAGCTGGTCTCCCCTGTGG - Intergenic
939113821 2:138038495-138038517 TGCTCAGCTATCCTTCCCTGGGG - Intergenic
939186476 2:138866870-138866892 TGCTCAGGTTGGCCTCCCAGAGG - Intergenic
947667959 2:231918928-231918950 TGCCCAGCGACTCCTCCCTGTGG + Intergenic
948758306 2:240172335-240172357 TGCTCAGCTCATTCTCCCTAAGG - Intergenic
949042578 2:241856121-241856143 TGCTCAGCTTCTCCTGGCTGGGG - Intronic
1171419939 20:25011373-25011395 GGCTGAGCCAGTACTCCCTGGGG - Intronic
1172168950 20:32917349-32917371 TGCTCAGGATGTCCTCCGTGTGG - Intronic
1173227185 20:41168799-41168821 AGGTCAGCTCGTCCTCCCTCTGG - Exonic
1177034063 21:16019854-16019876 TGCTCATCTTGGCCTCCCAGTGG + Intergenic
1177168668 21:17631784-17631806 TGCTCAGCTACCCCTACGTGTGG + Intergenic
1178766527 21:35458107-35458129 TGCTGAGCTAGTGGTCTCTGAGG + Intronic
1180782412 22:18528667-18528689 TCCTCACCAAGTCCTCCTTGTGG - Exonic
1180834115 22:18921305-18921327 TGCTGAGCTGGGCCTCACTGAGG + Intronic
1181065706 22:20304932-20304954 TGCTGAGCTGGGCCTCACTGAGG - Intergenic
1181125963 22:20702694-20702716 TCCTCACCAAGTCCTCCTTGTGG - Intergenic
1181464087 22:23101526-23101548 TGTTCTGCTAGGGCTCCCTGTGG - Intronic
1182122965 22:27798797-27798819 GGCTCAGCTAGGCCACCCCGGGG - Exonic
1182699759 22:32226997-32227019 TGCTCAGGGAGTCCTCTCTGAGG - Intronic
1183347915 22:37318192-37318214 TGCCAAGCTAGTCCTCCCTCAGG - Intergenic
1183544686 22:38449145-38449167 AGCTCAGCCACTCCTCCCTGTGG - Intronic
1184382988 22:44157795-44157817 GGCTCAGGTGATCCTCCCTGAGG - Intronic
1184407646 22:44309006-44309028 TGCCCAGCTGGTCCTGCCCGTGG + Intronic
1185166921 22:49267014-49267036 TGTCCAGCAAGACCTCCCTGGGG + Intergenic
1203284203 22_KI270734v1_random:146603-146625 TGCTGAGCTGGGCCTCACTGAGG + Intergenic
950188797 3:10961949-10961971 TGCTCATCTAGCGCTCCATGTGG - Intergenic
950259632 3:11534824-11534846 AGCTGAGCTACTCCTCCCTAGGG - Intronic
950472731 3:13196586-13196608 TGCTCACGCAGCCCTCCCTGTGG - Intergenic
950629492 3:14272827-14272849 GGCTCAGGTGATCCTCCCTGTGG + Intergenic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
954274082 3:49531372-49531394 TGCTCAGCTTGGCTACCCTGTGG + Exonic
955128323 3:56137427-56137449 TGCCCAGCTAGTCTTCTCTCTGG - Intronic
960279137 3:115761620-115761642 TGCTCACCTTGTCCTCCATTAGG + Intergenic
960932215 3:122864645-122864667 TGGTCAGCTATCACTCCCTGGGG - Intronic
961007644 3:123415474-123415496 TTCTGAGCTTGTCCTCCCAGGGG + Intronic
961697885 3:128718716-128718738 TGGTCAGAAAGTCCTCTCTGAGG - Intergenic
962235282 3:133701674-133701696 TGCTCAGAGAGGCCTCCCTGGGG + Intergenic
967112242 3:186304184-186304206 TAATCAGCTTGTCCGCCCTGGGG - Intronic
968653719 4:1769903-1769925 GGCTCAGCTGGGCCTCCCAGAGG + Intergenic
969125125 4:4941832-4941854 TGCTCAGCCAGGCTCCCCTGGGG + Intergenic
969257469 4:6011910-6011932 TGCTCAGCTGGTCCACCTTCCGG + Intergenic
969540233 4:7784175-7784197 CCCTCAGCCAATCCTCCCTGGGG - Intronic
972837877 4:42895946-42895968 TGCTCACTTTTTCCTCCCTGAGG - Intronic
973257955 4:48131870-48131892 TGCTGAGCTTGTCCTGCCAGTGG + Intronic
973740405 4:53914298-53914320 TCCTCAGCTAGTCCATTCTGTGG + Intronic
984395301 4:179190328-179190350 CTCTCAGCCAGCCCTCCCTGTGG - Intergenic
984937173 4:184899509-184899531 TGCTCAGCCAGGCCTGCTTGTGG - Intergenic
985638610 5:1052676-1052698 GTCTCTGCTCGTCCTCCCTGTGG - Intronic
987133534 5:14880929-14880951 TGCTCGGCCACTTCTCCCTGGGG - Intergenic
988404740 5:30809796-30809818 TGCTCAGTGAGTCTTTCCTGTGG + Intergenic
991531256 5:67617263-67617285 CGCTCAGCTACACCTGCCTGAGG - Intergenic
998521756 5:142807511-142807533 TGCTTAGCAAAACCTCCCTGAGG + Intronic
999666216 5:153916471-153916493 GTCTCAGCTAGTCCAGCCTGTGG - Intergenic
1002797330 6:484757-484779 TGCTCAGCTCTTCCTTCCAGCGG - Intergenic
1004015934 6:11731986-11732008 ACCTCACCTAGTTCTCCCTGAGG - Intronic
1006585246 6:35106247-35106269 TCTTCAGCTAGTCTCCCCTGGGG - Intergenic
1006716199 6:36122285-36122307 TGCACAGCTTCTCCTGCCTGAGG + Intergenic
1007751162 6:44072866-44072888 TGCACAGCTCCTACTCCCTGGGG - Intergenic
1010812260 6:80314406-80314428 TTCTCAGCTGGTCCAGCCTGTGG - Intronic
1012232723 6:96779173-96779195 TGTTCAGATATTCATCCCTGTGG - Intergenic
1013066302 6:106687377-106687399 TGCTCAAATTGTCCTCCCTTTGG + Intergenic
1015831811 6:137377878-137377900 TGGTCACCTGGTGCTCCCTGGGG + Intergenic
1016423748 6:143912824-143912846 TTCTCAGCTTGTCCAGCCTGTGG - Intronic
1017969960 6:159303801-159303823 TGCCCACCTGGTCCTCCCAGTGG + Intergenic
1018217107 6:161539063-161539085 TGTTCAGCTAGTGCCCCTTGGGG - Intronic
1019175167 6:170155710-170155732 TGCTCACCTAGTCCTCTGTGAGG - Intergenic
1019592523 7:1842838-1842860 CGCCCAGCTGGCCCTCCCTGTGG + Intronic
1021241056 7:18201548-18201570 TGCTCAGCTAGTCCTCCCTGAGG - Intronic
1022911069 7:34899980-34900002 TGCTCTGCCCCTCCTCCCTGTGG - Intergenic
1023956943 7:44894122-44894144 CACTCACCTAGTGCTCCCTGGGG + Intergenic
1029111664 7:98215890-98215912 TGCTGAGAAAGGCCTCCCTGGGG - Exonic
1029332989 7:99875490-99875512 TACTCAGCTACTCCTGGCTGAGG + Intergenic
1033977139 7:147116406-147116428 TTCTCAGCTAGTCCAGCCTGTGG - Intronic
1037761334 8:21743693-21743715 AACCCAGCCAGTCCTCCCTGGGG - Intronic
1040307617 8:46220367-46220389 TTCTCACCTAGGCCACCCTGCGG - Intergenic
1041391561 8:57351452-57351474 TGCACAGCTAGTGCTACCTAAGG - Intergenic
1041903653 8:63008718-63008740 TGTTCATCTAGTCCTCCCACAGG - Intergenic
1042489569 8:69381742-69381764 TTCTCAGCCAGTCCAGCCTGTGG + Intergenic
1044473790 8:92603047-92603069 TTCTCAGCTAATCTTCGCTGTGG + Intergenic
1046253012 8:111658470-111658492 TGCTCTGCAAGTCTTCCTTGGGG - Intergenic
1047423125 8:124723790-124723812 TGCTCTGCTTGTCCTGCCTTTGG + Intronic
1047973901 8:130110888-130110910 TGCTCAGCTCGTGCTCCCACAGG - Intronic
1049433999 8:142577875-142577897 TGGTGAGCTCTTCCTCCCTGGGG + Intergenic
1051173832 9:14345072-14345094 TCCTGAGCTCGGCCTCCCTGGGG + Intronic
1055724174 9:79209990-79210012 TCCTCAGCTTATCCTCCCTGAGG + Intergenic
1056754637 9:89374035-89374057 TCCTAAGCTGGTGCTCCCTGGGG + Intronic
1057205103 9:93167119-93167141 TCCTCAGCTGTTCCTGCCTGGGG - Intergenic
1057457649 9:95228807-95228829 TGCCCAGCAACTCCTTCCTGGGG - Intronic
1061720466 9:132547886-132547908 TGCCCAGGCAGCCCTCCCTGGGG + Intronic
1061801957 9:133117593-133117615 AGCTCAGCTTGTCCTGCATGAGG + Intronic
1062361483 9:136190297-136190319 GGCTCAGCTAGGTCTCCCAGAGG - Intergenic
1203793670 EBV:164745-164767 GGCTCATCAAGGCCTCCCTGAGG - Intergenic
1187244327 X:17540227-17540249 TCCTCAGCAACTCCTCCCTAGGG - Intronic
1189581666 X:42413676-42413698 TTCTCAGCTGGTCCAGCCTGTGG - Intergenic
1190056679 X:47185296-47185318 CTCTCGGCTAGTGCTCCCTGGGG - Exonic
1192589456 X:72347645-72347667 TGAGGAGCTAGCCCTCCCTGGGG + Intronic
1193207936 X:78771027-78771049 TGGCCAGCTAGTTCTACCTGAGG - Intergenic
1193907990 X:87265620-87265642 TACTGAGCTAGTGCTCCCAGAGG + Intergenic
1199157390 X:144566760-144566782 TGATCCTCTAGTCATCCCTGTGG - Intergenic
1199850216 X:151720912-151720934 AGCTCAGCCAGCCATCCCTGTGG - Intronic
1199852729 X:151737039-151737061 TGCTCACCTGGTGCTCTCTGCGG - Intergenic