ID: 1021242380

View in Genome Browser
Species Human (GRCh38)
Location 7:18219511-18219533
Sequence GTAAGCCATCTGCCAAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021242380 Original CRISPR GTAAGCCATCTGCCAAAATT TGG Intronic
901582240 1:10254300-10254322 GTAAGTTAGCAGCCAAAATTTGG - Intronic
901582403 1:10255623-10255645 GTAAGTTACCAGCCAAAATTTGG - Intronic
904971715 1:34424289-34424311 GTAGGCCAACTGCCAAGATGGGG + Intergenic
920558029 1:206918498-206918520 GTAAGATATATGCCAAACTTAGG + Intronic
923153705 1:231257380-231257402 TTCAGCAATCTGCTAAAATTGGG - Intronic
923388435 1:233489280-233489302 GTAGGCCAGCTACCAAATTTGGG + Intergenic
1066589404 10:36977364-36977386 GTAAGCAACCTGACAATATTTGG + Intergenic
1067781841 10:49213383-49213405 GTGAGCCATCTGCCCAAAGTTGG + Intergenic
1069238509 10:66108610-66108632 GTAACCCACCTGCCAAAAAAAGG - Intronic
1074222195 10:111448937-111448959 TTAAGTCAACTGCCAAACTTGGG + Intergenic
1074732080 10:116389837-116389859 TTAAGCCGTCTTCCTAAATTGGG + Intergenic
1074843986 10:117380537-117380559 GTAAGCAATCAGACAGAATTGGG - Intergenic
1074855816 10:117472677-117472699 ATGATCCATCTGCCAAAATGCGG - Intergenic
1075897219 10:126007100-126007122 GTGAGCCACCTGCCAGAATATGG - Intronic
1075988270 10:126807729-126807751 GTTAGACATTTGCCAAAATTTGG - Intergenic
1077469623 11:2751057-2751079 GTAGGCCCTCTGCCCAATTTGGG + Intronic
1078621571 11:12913380-12913402 GTCAGCCAGATCCCAAAATTTGG + Intronic
1078919482 11:15816056-15816078 CTAAGCCATTCGCCAAAATTAGG - Intergenic
1082730319 11:56788709-56788731 CTAAGCCATTTGCAAAATTTAGG - Intergenic
1088600046 11:111465841-111465863 GTTAGCCAAAAGCCAAAATTAGG - Intergenic
1088943180 11:114481165-114481187 TTAAGCCTTCTGTCAAAAGTGGG - Intergenic
1090720176 11:129465413-129465435 CTAACCCATTTTCCAAAATTGGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1094345221 12:29460708-29460730 TTAAGCCATCTGCCATAGTGAGG - Intronic
1095736851 12:45567010-45567032 GTTGGCCATCTACCCAAATTAGG + Intergenic
1097202020 12:57287189-57287211 GTAATCCAGCTGACCAAATTAGG + Intronic
1098713218 12:73793894-73793916 GTAAACCATCTGAAAAAATTAGG + Intergenic
1106197538 13:27507271-27507293 GAAATCCATCTGGAAAAATTTGG + Intergenic
1110787224 13:79543390-79543412 ATAAGCCATTTGCAAAAAGTAGG + Intronic
1115263863 14:31480697-31480719 GTAAGCTATCTCCAAAATTTGGG - Intergenic
1116107848 14:40533611-40533633 TTAAGCCTTTTGCCAAATTTAGG - Intergenic
1116923710 14:50610483-50610505 GAAAACCATATGGCAAAATTTGG + Intronic
1118121336 14:62847383-62847405 GAAAGACATCTGCCAAATTCTGG - Intronic
1133898426 16:9950659-9950681 CTAAGCCATCTCCCATGATTTGG - Intronic
1135196034 16:20395590-20395612 GTAAGCCACCTGCTATAGTTTGG + Intronic
1135288601 16:21215233-21215255 GGAAGACATCTGCCCAAATGAGG - Intergenic
1144362921 17:14512686-14512708 TTTAGCCATCAGCTAAAATTTGG + Intergenic
1144485892 17:15663988-15664010 GCAAACCATCTGCTAAAATGGGG + Intronic
1145122976 17:20277326-20277348 GTAAGCCATCTTACCCAATTAGG - Intronic
1147349379 17:39828223-39828245 TTACCCCATCTGGCAAAATTGGG + Intronic
1148996329 17:51713450-51713472 GTAAGTCATTTGACAAAAATAGG + Intronic
1151457968 17:74237948-74237970 ATAAGCCATTGGCCAAAATCAGG + Intronic
1155952778 18:31931579-31931601 GTAAACCATCAGCCCAATTTTGG - Intronic
1158499937 18:57991545-57991567 GTCAGCCATCATCCAATATTTGG + Intergenic
927736929 2:25532582-25532604 GTAAGCAACATGCCACAATTAGG + Intronic
929282549 2:40097071-40097093 TTAAGCATTCTCCCAAAATTTGG + Intergenic
931263203 2:60638185-60638207 GTAAGTCATCTGCAAGTATTAGG - Intergenic
932552542 2:72785820-72785842 TTAAGCCAGCTGCAGAAATTTGG - Intronic
1170817389 20:19725640-19725662 GTAAGCCATCTGAACAACTTTGG - Intergenic
1177632512 21:23746048-23746070 GGAAGACATTTGCCAAAATGTGG + Intergenic
1178153271 21:29820890-29820912 GTAAGCAATGTGCCAGGATTTGG + Intronic
1181958418 22:26605113-26605135 GGAAGCCAGCTCCCAAAGTTTGG - Intronic
1184670432 22:46009579-46009601 TTCTGCCATCTGCCAAAGTTGGG - Intergenic
1184883979 22:47330910-47330932 GTCAGCCAGCTGCCAACATCGGG - Intergenic
951108420 3:18772342-18772364 TTAAACCATTTGACAAAATTGGG + Intergenic
952252873 3:31671628-31671650 GAAAGACATCTGCCAAGAGTGGG + Intronic
955689133 3:61573378-61573400 GAAATCCATGTGCAAAAATTAGG - Intronic
957036328 3:75296674-75296696 GTCATCCATATGCCAAAAATGGG + Intergenic
970115534 4:12690804-12690826 GAAAGCCATATGTCTAAATTTGG - Intergenic
970627182 4:17899646-17899668 GTTATCAATATGCCAAAATTGGG - Intronic
970689632 4:18607637-18607659 GTAAACCATCATACAAAATTTGG - Intergenic
972262276 4:37421258-37421280 GTAAGGCAACTGCCAGGATTAGG + Intronic
982689812 4:158535296-158535318 GTAAGCCATGTGCCAGAGTTAGG + Intronic
985159893 4:187033838-187033860 TCAAGCCATCTGCAGAAATTTGG + Intergenic
986855733 5:11866499-11866521 GTTAACCATCTACAAAAATTAGG + Intronic
986926837 5:12764961-12764983 TTCAGGCATCTGCCAAAATCAGG - Intergenic
987074259 5:14366038-14366060 TTAAGCCCTCTTCCAAAGTTGGG + Intronic
987074279 5:14366158-14366180 CTAAGCCCTCTCCCAAAGTTGGG - Intronic
994169656 5:96644633-96644655 GTGATACATCTGTCAAAATTAGG + Intronic
994386344 5:99137331-99137353 GAAAAGCATCTGCCACAATTTGG - Intergenic
994569671 5:101499636-101499658 GCAAGCCAACTGCCAAAATAGGG + Intergenic
994746246 5:103681946-103681968 TTAGGCCATCTGCCCAACTTGGG - Intergenic
995539511 5:113170868-113170890 GCCAGCCATCTGGCAATATTTGG - Intronic
996343499 5:122464721-122464743 GTAGGTCATCTGACAAACTTGGG + Intergenic
997964427 5:138346318-138346340 GTAAACTTTCTGACAAAATTTGG - Intronic
998335974 5:141372377-141372399 GCAAGCTATCTGCGAAGATTAGG - Exonic
1000457738 5:161472667-161472689 GTACACCCTCTGCCAAAACTAGG - Intronic
1000813419 5:165890601-165890623 TCACCCCATCTGCCAAAATTGGG + Intergenic
1013395437 6:109733037-109733059 GTAAATAATCTGGCAAAATTGGG + Intronic
1013795090 6:113878780-113878802 CTAAGCCATCTGCTTTAATTTGG - Intergenic
1014894136 6:126880567-126880589 GTGAGCTATCTTCCAAAATCTGG + Intergenic
1019041992 6:169113813-169113835 GGAACCCTTCTGCCAAACTTTGG - Intergenic
1020592125 7:10153148-10153170 GTAATGCATCTGGTAAAATTGGG - Intergenic
1021242380 7:18219511-18219533 GTAAGCCATCTGCCAAAATTTGG + Intronic
1022983739 7:35629100-35629122 GTGAGCCAGCTGGCCAAATTGGG + Intergenic
1026531416 7:71201018-71201040 GTTATCTCTCTGCCAAAATTGGG + Intronic
1029321304 7:99762941-99762963 TTCAGACCTCTGCCAAAATTGGG - Intronic
1030459211 7:109809461-109809483 GTCAGCTTTCTGCCAAAAGTTGG + Intergenic
1030707578 7:112710476-112710498 GTAAGCAAGCTGCAAAACTTGGG - Intergenic
1037987028 8:23296422-23296444 GCAACCCAGCTCCCAAAATTGGG - Intergenic
1039156106 8:34559411-34559433 GACAGTCATCTGCCAAAATCTGG + Intergenic
1039449056 8:37657001-37657023 GTAAGGCACTTGCCAAAAATAGG + Intergenic
1042546263 8:69954223-69954245 GAAACCCATCTTCCAAAATGAGG + Intergenic
1043572579 8:81621535-81621557 GTCACCAATCTGCCAAAAGTGGG - Intergenic
1046456652 8:114473526-114473548 GTAACACTTCTGCCAAAATTTGG + Intergenic
1047542032 8:125777211-125777233 GGAAACCATCAGTCAAAATTTGG + Intergenic
1061765814 9:132880575-132880597 GTAAGCCCTGGGCCAACATTAGG + Intronic
1186743879 X:12546072-12546094 GAAAGTGATATGCCAAAATTTGG - Intronic
1187839440 X:23471626-23471648 GCTAGCCATCTGGCATAATTTGG + Intergenic
1189063864 X:37785130-37785152 TTAAACCAACTGCCAAAATTGGG + Intronic
1189516344 X:41716743-41716765 TTATCCCATCTGGCAAAATTGGG + Intronic
1190364597 X:49679876-49679898 GGAAGCCCCCTGCCAAAATTGGG + Intergenic
1194567101 X:95503521-95503543 GAAAGGCATCTGTTAAAATTTGG - Intergenic
1194984645 X:100477501-100477523 TTTAGTCATCTGCCAAAATGTGG + Intergenic
1197288332 X:124623697-124623719 GTAAATCAGCTGCCAAAGTTGGG + Intronic